EMAIL THIS PAGE TO A FRIEND

CCDC40

coiled-coil domain containing 40

Synonyms: CILD15
Gene ID:
Human(55036) Summary: This gene encodes a protein that is necessary for motile cilia function. It functions in correct left-right axis formation by regulating the assembly of the inner dynein arm and the dynein regulatory complexes, which control ciliary beat. Mutations in this gene cause ciliary dyskinesia type 15, a disorder due to defects in cilia motility. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Mouse(207607) coiled-coil domain containing 40
Rat(287867) coiled-coil domain containing 40
Zebrafish(568590) coiled-coil domain containing 40
chicken(422083) coiled-coil domain containing 40
domestic cat(101094222) coiled-coil domain containing 40
cow(529788) coiled-coil domain containing 40
Horse(100056721) coiled-coil domain containing 40
dog(483351) coiled-coil domain containing 40
sheep(101110430) coiled-coil domain containing 40
naked mole-rat(101718271) coiled-coil domain containing 40
domestic guinea pig(100733015) coiled-coil domain containing 40
145 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017950 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017950 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017950 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175430 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175430 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175430 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017950 Rosetta Predictions human pricing
XM_371082 Rosetta Predictions human pricing
XM_930250 Rosetta Predictions human pricing
XM_934509 Rosetta Predictions human pricing
XM_934511 Rosetta Predictions human pricing
XM_934512 Rosetta Predictions human pricing
XM_934513 Rosetta Predictions human pricing
XM_934515 Rosetta Predictions human pricing
XM_934518 Rosetta Predictions human pricing
XM_934521 Rosetta Predictions human pricing
XM_934522 Rosetta Predictions human pricing
NM_001134688 Rosetta Predictions rat pricing
NM_175430 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017950 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00350970 predicted 565
2 SASI_Hs02_00350971 predicted 1944
3 SASI_Hs02_00350972 predicted 1999
4 SASI_Hs02_00350973 predicted 302
5 SASI_Hs02_00350974 predicted 2741
6 SASI_Hs02_00350975 predicted 341
7 SASI_Hs02_00350976 predicted 3494
8 SASI_Hs02_00350977 predicted 1632
9 SASI_Hs02_00350978 predicted 355
10 SASI_Hs02_00350979 predicted 269
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_371082 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00295321 predicted 903
2 SASI_Hs01_00295322 predicted 847
3 SASI_Hs01_00295323 predicted 826
4 SASI_Hs01_00295324 predicted 889
5 SASI_Hs01_00295325 predicted 900
6 SASI_Hs01_00295326 predicted 840
7 SASI_Hs01_00295327 predicted 849
8 SASI_Hs01_00295328 predicted 897
9 SASI_Hs01_00295329 predicted 904
10 SASI_Hs01_00295330 predicted 814
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930250 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00282404 predicted 563
2 SASI_Hs01_00282405 predicted 642
3 SASI_Hs01_00282406 predicted 555
4 SASI_Hs01_00282407 predicted 503
5 SASI_Hs01_00282408 predicted 566
6 SASI_Hs01_00282409 predicted 641
7 SASI_Hs01_00282410 predicted 633
8 SASI_Hs01_00282411 predicted 489
9 SASI_Hs01_00282412 predicted 523
10 SASI_Hs01_00282413 predicted 508
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934509 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00282886 predicted 3232
2 SASI_Hs01_00282887 predicted 3229
3 SASI_Hs01_00282888 predicted 3004
4 SASI_Hs01_00282889 predicted 2958
5 SASI_Hs01_00282890 predicted 3363
6 SASI_Hs01_00282891 predicted 3017
7 SASI_Hs01_00282892 predicted 3408
8 SASI_Hs01_00282893 predicted 3047
9 SASI_Hs01_00282894 predicted 2868
10 SASI_Hs01_00282895 predicted 3539
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934511 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00291383 predicted 561
2 SASI_Hs01_00291384 predicted 650
3 SASI_Hs01_00291385 predicted 548
4 SASI_Hs01_00291386 predicted 503
5 SASI_Hs01_00291387 predicted 560
6 SASI_Hs01_00291388 predicted 636
7 SASI_Hs01_00291389 predicted 633
8 SASI_Hs01_00291390 predicted 490
9 SASI_Hs01_00291391 predicted 521
10 SASI_Hs01_00291392 predicted 512
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934512 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00287276 predicted 563
2 SASI_Hs01_00287277 predicted 648
3 SASI_Hs01_00287278 predicted 551
4 SASI_Hs01_00287279 predicted 499
5 SASI_Hs01_00287280 predicted 564
6 SASI_Hs01_00287281 predicted 634
7 SASI_Hs01_00287282 predicted 628
8 SASI_Hs01_00287283 predicted 493
9 SASI_Hs01_00287284 predicted 531
10 SASI_Hs01_00287285 predicted 510
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934513 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00271254 predicted 1573
2 SASI_Hs01_00271255 predicted 1337
3 SASI_Hs01_00271256 predicted 1556
4 SASI_Hs01_00271257 predicted 1715
5 SASI_Hs01_00271258 predicted 1318
6 SASI_Hs01_00271259 predicted 1466
7 SASI_Hs01_00271260 predicted 1779
8 SASI_Hs01_00271261 predicted 1724
9 SASI_Hs01_00271262 predicted 1331
10 SASI_Hs01_00271263 predicted 1648
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934515 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00282464 predicted 562
2 SASI_Hs01_00282465 predicted 649
3 SASI_Hs01_00282466 predicted 552
4 SASI_Hs01_00282467 predicted 497
5 SASI_Hs01_00282468 predicted 566
6 SASI_Hs01_00282469 predicted 643
7 SASI_Hs01_00282470 predicted 636
8 SASI_Hs01_00282471 predicted 491
9 SASI_Hs01_00282472 predicted 531
10 SASI_Hs01_00282473 predicted 518
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934518 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00291016 predicted 566
2 SASI_Hs01_00291017 predicted 641
3 SASI_Hs01_00291018 predicted 552
4 SASI_Hs01_00291019 predicted 493
5 SASI_Hs01_00291020 predicted 565
6 SASI_Hs01_00291021 predicted 643
7 SASI_Hs01_00291022 predicted 636
8 SASI_Hs01_00291023 predicted 496
9 SASI_Hs01_00291024 predicted 528
10 SASI_Hs01_00291025 predicted 512
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934521 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00258740 predicted 562
2 SASI_Hs01_00258741 predicted 642
3 SASI_Hs01_00258742 predicted 556
4 SASI_Hs01_00258743 predicted 493
5 SASI_Hs01_00258744 predicted 565
6 SASI_Hs01_00258745 predicted 640
7 SASI_Hs01_00258746 predicted 631
8 SASI_Hs01_00258747 predicted 489
9 SASI_Hs01_00258748 predicted 527
10 SASI_Hs01_00258749 predicted 509
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934522 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00249923 predicted 413
2 SASI_Hs01_00249924 predicted 602
3 SASI_Hs01_00249925 predicted 348
4 SASI_Hs01_00249926 predicted 399
5 SASI_Hs01_00249927 predicted 1889
6 SASI_Hs01_00249928 predicted 1220
7 SASI_Hs01_00249929 predicted 1957
8 SASI_Hs01_00249930 predicted 820
9 SASI_Hs01_00249931 predicted 1591
10 SASI_Hs01_00249932 predicted 360
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134688 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00257929 predicted 656
2 SASI_Rn02_00257930 predicted 2330
3 SASI_Rn02_00257931 predicted 3555
4 SASI_Rn02_00257932 predicted 3450
5 SASI_Rn02_00257933 predicted 2546
6 SASI_Rn02_00257934 predicted 720
7 SASI_Rn02_00257935 predicted 3482
8 SASI_Rn02_00257936 predicted 2201
9 SASI_Rn02_00257937 predicted 1685
10 SASI_Rn02_00257938 predicted 798
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175430 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00084615 predicted 1584
2 SASI_Mm01_00084616 predicted 1102
3 SASI_Mm01_00084617 predicted 1071
4 SASI_Mm01_00084618 predicted 703
5 SASI_Mm01_00084619 predicted 1036
6 SASI_Mm01_00084620 predicted 3566
7 SASI_Mm02_00346307 predicted 1042
8 SASI_Mm01_00084621 predicted 3369
9 SASI_Mm01_00084622 predicted 1309
10 SASI_Mm01_00084623 predicted 2648
11 SASI_Mm01_00084624 predicted 3476
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017950
CCDC40 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 40
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017950.2-1620s21c1
Sequence:CCGGCGGCGAGATTGAGGCCTATAACTCGAGTTATAGGCCTCAATCTCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017950.2-2731s21c1
Sequence:CCGGGAAGCAGAACACCAGATTATGCTCGAGCATAATCTGGTGTTCTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017950.2-299s21c1
Sequence:CCGGGCGAAGAGGAATATTACTATACTCGAGTATAGTAATATTCCTCTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253735    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017950.2-3616s21c1
Sequence:CCGGTTAGCCACTCAGCAATTTAATCTCGAGATTAAATTGCTGAGTGGCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017950.2-2552s21c1
Sequence:CCGGAGCTCAACATGTTGATGAATACTCGAGTATTCATCAACATGTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017950
CCDC40 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 40
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017950.2-1620s21c1
Sequence:CCGGCGGCGAGATTGAGGCCTATAACTCGAGTTATAGGCCTCAATCTCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017950.2-2731s21c1
Sequence:CCGGGAAGCAGAACACCAGATTATGCTCGAGCATAATCTGGTGTTCTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017950.2-299s21c1
Sequence:CCGGGCGAAGAGGAATATTACTATACTCGAGTATAGTAATATTCCTCTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253735    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017950.2-3616s21c1
Sequence:CCGGTTAGCCACTCAGCAATTTAATCTCGAGATTAAATTGCTGAGTGGCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017950.2-2552s21c1
Sequence:CCGGAGCTCAACATGTTGATGAATACTCGAGTATTCATCAACATGTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017950
CCDC40 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 40
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017950.2-1620s21c1
Sequence:CCGGCGGCGAGATTGAGGCCTATAACTCGAGTTATAGGCCTCAATCTCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017950.2-2731s21c1
Sequence:CCGGGAAGCAGAACACCAGATTATGCTCGAGCATAATCTGGTGTTCTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017950.2-299s21c1
Sequence:CCGGGCGAAGAGGAATATTACTATACTCGAGTATAGTAATATTCCTCTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253735    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017950.2-3616s21c1
Sequence:CCGGTTAGCCACTCAGCAATTTAATCTCGAGATTAAATTGCTGAGTGGCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017950.2-2552s21c1
Sequence:CCGGAGCTCAACATGTTGATGAATACTCGAGTATTCATCAACATGTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175430
CCDC40 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 40
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000181216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175430.2-2841s1c1
Sequence:CCGGCCTGGTGACACATCTTTCAAACTCGAGTTTGAAAGATGTGTCACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175430.2-3786s1c1
Sequence:CCGGGCAGAGCAAGATAGACAAGAACTCGAGTTCTTGTCTATCTTGCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195992    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175430.2-4599s1c1
Sequence:CCGGCGGAGCAAGTAATGCAGAGAACTCGAGTTCTCTGCATTACTTGCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175430.2-4008s1c1
Sequence:CCGGCAACCAGCTAACAGCTCTCAACTCGAGTTGAGAGCTGTTAGCTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175430.2-2385s1c1
Sequence:CCGGCGAGGCATACAAGACAGTGATCTCGAGATCACTGTCTTGTATGCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175430
CCDC40 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 40
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000181216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175430.2-2841s1c1
Sequence:CCGGCCTGGTGACACATCTTTCAAACTCGAGTTTGAAAGATGTGTCACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175430.2-3786s1c1
Sequence:CCGGGCAGAGCAAGATAGACAAGAACTCGAGTTCTTGTCTATCTTGCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195992    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175430.2-4599s1c1
Sequence:CCGGCGGAGCAAGTAATGCAGAGAACTCGAGTTCTCTGCATTACTTGCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175430.2-4008s1c1
Sequence:CCGGCAACCAGCTAACAGCTCTCAACTCGAGTTGAGAGCTGTTAGCTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175430.2-2385s1c1
Sequence:CCGGCGAGGCATACAAGACAGTGATCTCGAGATCACTGTCTTGTATGCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175430
CCDC40 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 40
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000181216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175430.2-2841s1c1
Sequence:CCGGCCTGGTGACACATCTTTCAAACTCGAGTTTGAAAGATGTGTCACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175430.2-3786s1c1
Sequence:CCGGGCAGAGCAAGATAGACAAGAACTCGAGTTCTTGTCTATCTTGCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195992    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175430.2-4599s1c1
Sequence:CCGGCGGAGCAAGTAATGCAGAGAACTCGAGTTCTCTGCATTACTTGCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175430.2-4008s1c1
Sequence:CCGGCAACCAGCTAACAGCTCTCAACTCGAGTTGAGAGCTGTTAGCTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175430.2-2385s1c1
Sequence:CCGGCGAGGCATACAAGACAGTGATCTCGAGATCACTGTCTTGTATGCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks