EMAIL THIS PAGE TO A FRIEND

CCDC41

coiled-coil domain containing 41

78 Gene Product Result for
Synonyms: Cep83 NY-REN-58
UniProtKB ID: Q9Y592, A4FVB1, Q08AP1
Gene ID:
Mouse(77048) coiled-coil domain containing 41
Rat(366872) coiled-coil domain containing 41
domestic guinea pig(100713406) coiled-coil domain containing 41
naked mole-rat(101715068) coiled-coil domain containing 41
sheep(101115779) coiled-coil domain containing 41
Domestic Rabbit(100355030) coiled-coil domain containing 41
Zebrafish(100007472) coiled-coil domain containing 41
chicken(417904) coiled-coil domain containing 41
domestic cat(101090532) coiled-coil domain containing 41
cow(618145) coiled-coil domain containing 41
Horse(100052015) coiled-coil domain containing 41
dog(482606) coiled-coil domain containing 41
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029852 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029852 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029852 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016122 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016122 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016122 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042399 Rosetta Predictions human pricing
NM_016122 Rosetta Predictions human pricing
NM_001014266 Rosetta Predictions rat pricing
NM_029852 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042399 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00309518 predicted 2456
2 SASI_Hs02_00309519 predicted 2464
3 SASI_Hs02_00309520 predicted 934
4 SASI_Hs02_00309521 predicted 850
5 SASI_Hs02_00309522 predicted 1158
6 SASI_Hs02_00309523 predicted 2631
7 SASI_Hs02_00309524 predicted 663
8 SASI_Hs02_00309525 predicted 1025
9 SASI_Hs02_00309526 predicted 2357
10 SASI_Hs02_00309527 predicted 2605
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016122 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00348895 predicted 2512
2 SASI_Hs02_00348896 predicted 2520
3 SASI_Hs01_00038714 predicted 984
4 SASI_Hs02_00348897 predicted 898
5 SASI_Hs01_00038717 predicted 1208
6 SASI_Hs02_00348898 predicted 2677
7 SASI_Hs02_00348899 predicted 718
8 SASI_Hs01_00038720 predicted 1083
9 SASI_Hs01_00038719 predicted 2415
10 SASI_Hs02_00348900 predicted 2664
11 SASI_Hs01_00038713 predicted 1543
12 SASI_Hs01_00038715 predicted 2054
13 SASI_Hs01_00038716 predicted 1924
14 SASI_Hs01_00038718 predicted 2088
15 SASI_Hs01_00038721 predicted 1636
16 SASI_Hs01_00038722 predicted 1923
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014266 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00097749 predicted 405
2 SASI_Rn01_00097750 predicted 355
3 SASI_Rn01_00097751 predicted 2180
4 SASI_Rn01_00097752 predicted 1255
5 SASI_Rn02_00201835 predicted 1571
6 SASI_Rn01_00097755 predicted 980
7 SASI_Rn01_00097756 predicted 536
8 SASI_Rn02_00201836 predicted 363
9 SASI_Rn01_00097757 predicted 326
10 SASI_Rn01_00097758 predicted 862
11 SASI_Rn01_00097753 predicted 647
12 SASI_Rn01_00097754 predicted 1482
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029852 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00146704 predicted 379
2 SASI_Mm01_00146705 predicted 706
3 SASI_Mm01_00146706 predicted 1405
4 SASI_Mm01_00146707 predicted 1343
5 SASI_Mm01_00146708 predicted 637
6 SASI_Mm01_00146709 predicted 926
7 SASI_Mm01_00146710 predicted 2275
8 SASI_Mm01_00146712 predicted 1200
9 SASI_Mm02_00336077 predicted 950
10 SASI_Mm01_00146713 predicted 891
11 SASI_Mm01_00146711 predicted 2446
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029852
CCDC41 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 41
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200726    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029852.1-1336s1c1
Sequence:CCGGGAACTACAATCAAGCAATGAACTCGAGTTCATTGCTTGATTGTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191282    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029852.1-1846s1c1
Sequence:CCGGCAACAAATTGTGAATACCGAACTCGAGTTCGGTATTCACAATTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192676    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029852.1-2609s1c1
Sequence:CCGGGCAAAGCCAGAGACTCAATAACTCGAGTTATTGAGTCTCTGGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248030    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029852.2-2472s21c1
Sequence:CCGGGCAAAGCCAGAGACTCAATAACTCGAGTTATTGAGTCTCTGGCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029852.2-1681s21c1
Sequence:CCGGGCTGCAGAGCACTAGGTTAAACTCGAGTTTAACCTAGTGCTCTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029852.2-469s21c1
Sequence:CCGGGGTACGCTGTGAACATCATAACTCGAGTTATGATGTTCACAGCGTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215427    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029852.2-1469s1c1
Sequence:CCGGGATCGTGAATTAATACGTAAACTCGAGTTTACGTATTAATTCACGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029852.2-798s21c1
Sequence:CCGGACAAGCTGCGCTACGAGTATACTCGAGTATACTCGTAGCGCAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029852.2-1469s21c1
Sequence:CCGGGATCGTGAATTAATACGTAAACTCGAGTTTACGTATTAATTCACGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029852
CCDC41 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 41
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200726    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029852.1-1336s1c1
Sequence:CCGGGAACTACAATCAAGCAATGAACTCGAGTTCATTGCTTGATTGTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191282    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029852.1-1846s1c1
Sequence:CCGGCAACAAATTGTGAATACCGAACTCGAGTTCGGTATTCACAATTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192676    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029852.1-2609s1c1
Sequence:CCGGGCAAAGCCAGAGACTCAATAACTCGAGTTATTGAGTCTCTGGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248030    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029852.2-2472s21c1
Sequence:CCGGGCAAAGCCAGAGACTCAATAACTCGAGTTATTGAGTCTCTGGCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029852.2-1681s21c1
Sequence:CCGGGCTGCAGAGCACTAGGTTAAACTCGAGTTTAACCTAGTGCTCTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029852.2-469s21c1
Sequence:CCGGGGTACGCTGTGAACATCATAACTCGAGTTATGATGTTCACAGCGTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215427    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029852.2-1469s1c1
Sequence:CCGGGATCGTGAATTAATACGTAAACTCGAGTTTACGTATTAATTCACGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029852.2-798s21c1
Sequence:CCGGACAAGCTGCGCTACGAGTATACTCGAGTATACTCGTAGCGCAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029852.2-1469s21c1
Sequence:CCGGGATCGTGAATTAATACGTAAACTCGAGTTTACGTATTAATTCACGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029852
CCDC41 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 41
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200726    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029852.1-1336s1c1
Sequence:CCGGGAACTACAATCAAGCAATGAACTCGAGTTCATTGCTTGATTGTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191282    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029852.1-1846s1c1
Sequence:CCGGCAACAAATTGTGAATACCGAACTCGAGTTCGGTATTCACAATTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192676    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029852.1-2609s1c1
Sequence:CCGGGCAAAGCCAGAGACTCAATAACTCGAGTTATTGAGTCTCTGGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248030    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029852.2-2472s21c1
Sequence:CCGGGCAAAGCCAGAGACTCAATAACTCGAGTTATTGAGTCTCTGGCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029852.2-1681s21c1
Sequence:CCGGGCTGCAGAGCACTAGGTTAAACTCGAGTTTAACCTAGTGCTCTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029852.2-469s21c1
Sequence:CCGGGGTACGCTGTGAACATCATAACTCGAGTTATGATGTTCACAGCGTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215427    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029852.2-1469s1c1
Sequence:CCGGGATCGTGAATTAATACGTAAACTCGAGTTTACGTATTAATTCACGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029852.2-798s21c1
Sequence:CCGGACAAGCTGCGCTACGAGTATACTCGAGTATACTCGTAGCGCAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029852.2-1469s21c1
Sequence:CCGGGATCGTGAATTAATACGTAAACTCGAGTTTACGTATTAATTCACGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016122
VALIDATED
CCDC41 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 41
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168620    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016122.1-993s1c1
Sequence:CCGGGTAGCGGAATTAAAGGCTGAACTCGAGTTCAGCCTTTAATTCCGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168559    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016122.1-1149s1c1
Sequence:CCGGGAGCTACAATCAAGCAGTGAACTCGAGTTCACTGCTTGATTGTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167263    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016122.1-765s1c1
Sequence:CCGGCATACATTTCTCAAGTCAGAACTCGAGTTCTGACTTGAGAAATGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016122.2-704s21c1
Sequence:CCGGTTACGATGTGAGCATCATAAACTCGAGTTTATGATGCTCACATCGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242818    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_016122.2-2820s21c1
Sequence:CCGGGTACCTACTACATGCTGTATTCTCGAGAATACAGCATGTAGTAGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_016122.2-1703s21c1
Sequence:CCGGGATCGTGAATTAATACGTAAACTCGAGTTTACGTATTAATTCACGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_016122.2-1269s21c1
Sequence:CCGGAGGCTGAAGTAGCGGAATTAACTCGAGTTAATTCCGCTACTTCAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_016122.2-1480s21c1
Sequence:CCGGGCATAAAGCTGAACGAGAAATCTCGAGATTTCTCGTTCAGCTTTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016122
VALIDATED
CCDC41 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 41
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168620    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016122.1-993s1c1
Sequence:CCGGGTAGCGGAATTAAAGGCTGAACTCGAGTTCAGCCTTTAATTCCGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168559    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016122.1-1149s1c1
Sequence:CCGGGAGCTACAATCAAGCAGTGAACTCGAGTTCACTGCTTGATTGTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167263    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016122.1-765s1c1
Sequence:CCGGCATACATTTCTCAAGTCAGAACTCGAGTTCTGACTTGAGAAATGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016122.2-704s21c1
Sequence:CCGGTTACGATGTGAGCATCATAAACTCGAGTTTATGATGCTCACATCGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242818    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_016122.2-2820s21c1
Sequence:CCGGGTACCTACTACATGCTGTATTCTCGAGAATACAGCATGTAGTAGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_016122.2-1703s21c1
Sequence:CCGGGATCGTGAATTAATACGTAAACTCGAGTTTACGTATTAATTCACGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_016122.2-1269s21c1
Sequence:CCGGAGGCTGAAGTAGCGGAATTAACTCGAGTTAATTCCGCTACTTCAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_016122.2-1480s21c1
Sequence:CCGGGCATAAAGCTGAACGAGAAATCTCGAGATTTCTCGTTCAGCTTTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016122
VALIDATED
CCDC41 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 41
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168620    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016122.1-993s1c1
Sequence:CCGGGTAGCGGAATTAAAGGCTGAACTCGAGTTCAGCCTTTAATTCCGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168559    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016122.1-1149s1c1
Sequence:CCGGGAGCTACAATCAAGCAGTGAACTCGAGTTCACTGCTTGATTGTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167263    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016122.1-765s1c1
Sequence:CCGGCATACATTTCTCAAGTCAGAACTCGAGTTCTGACTTGAGAAATGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016122.2-704s21c1
Sequence:CCGGTTACGATGTGAGCATCATAAACTCGAGTTTATGATGCTCACATCGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242818    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_016122.2-2820s21c1
Sequence:CCGGGTACCTACTACATGCTGTATTCTCGAGAATACAGCATGTAGTAGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_016122.2-1703s21c1
Sequence:CCGGGATCGTGAATTAATACGTAAACTCGAGTTTACGTATTAATTCACGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_016122.2-1269s21c1
Sequence:CCGGAGGCTGAAGTAGCGGAATTAACTCGAGTTAATTCCGCTACTTCAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_016122.2-1480s21c1
Sequence:CCGGGCATAAAGCTGAACGAGAAATCTCGAGATTTCTCGTTCAGCTTTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks