EMAIL THIS PAGE TO A FRIEND

CCDC42

coiled-coil domain containing 42

Synonyms: CCDC42A
UniProtKB ID: Q96M95, Q8N6Q0
Gene ID:
Mouse(276920) coiled-coil domain containing 42
Rat(303234) coiled-coil domain containing 42
naked mole-rat(101720223) coiled-coil domain containing 42
domestic guinea pig(100731720) coiled-coil domain containing 42
sheep(101109283) coiled-coil domain containing 42
chicken(417318) coiled-coil domain containing 42
cow(536427) coiled-coil domain containing 42
domestic cat(101083304) coiled-coil domain containing 42
dog(479498) coiled-coil domain containing 42
53 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144681 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144681 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144681 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177779 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177779 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177779 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU078861 MISSION® esiRNA esiRNA human CCDC42 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144681 Rosetta Predictions human pricing
NM_001107009 Rosetta Predictions rat pricing
NM_177779 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144681 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00069102 predicted 434
2 SASI_Hs01_00069104 predicted 920
3 SASI_Hs01_00069105 predicted 1090
4 SASI_Hs01_00069106 predicted 731
5 SASI_Hs01_00069107 predicted 1149
6 SASI_Hs01_00069108 predicted 336
7 SASI_Hs01_00069109 predicted 410
8 SASI_Hs01_00069110 predicted 367
9 SASI_Hs01_00069111 predicted 484
10 SASI_Hs02_00364581 predicted 344
11 SASI_Hs01_00069103 predicted 412
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107009 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00224586 predicted 197
2 SASI_Rn02_00224587 predicted 1019
3 SASI_Rn02_00224588 predicted 800
4 SASI_Rn02_00224589 predicted 674
5 SASI_Rn02_00224590 predicted 1100
6 SASI_Rn02_00224591 predicted 1034
7 SASI_Rn02_00224592 predicted 494
8 SASI_Rn02_00224593 predicted 1085
9 SASI_Rn02_00224594 predicted 1059
10 SASI_Rn02_00224595 predicted 357
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177779 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00348179 predicted 212
2 SASI_Mm02_00348180 predicted 503
3 SASI_Mm02_00348181 predicted 603
4 SASI_Mm01_00135041 predicted 1039
5 SASI_Mm01_00135042 predicted 935
6 SASI_Mm02_00348182 predicted 802
7 SASI_Mm02_00348183 predicted 808
8 SASI_Mm01_00135043 predicted 793
9 SASI_Mm02_00348184 predicted 212
10 SASI_Mm02_00348185 predicted 362
11 SASI_Mm01_00135040 predicted 400
12 SASI_Mm01_00135044 predicted 242
13 SASI_Mm01_00135045 predicted 473
14 SASI_Mm01_00135046 predicted 370
15 SASI_Mm01_00135047 predicted 286
16 SASI_Mm01_00135048 predicted 412
17 SASI_Mm01_00135049 predicted 325
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144681
CCDC42 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 42
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000441443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144681.2-265s21c1
Sequence:CCGGAGTACTTCCGGCTGCAGTATGCTCGAGCATACTGCAGCCGGAAGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144681.2-467s21c1
Sequence:CCGGCGTTAAGGAAGCCCAACTGAACTCGAGTTCAGTTGGGCTTCCTTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144681.1-1091s1c1
Sequence:CCGGGCTGGACATGATCCAGCAATTCTCGAGAATTGCTGGATCATGTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130383    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144681.1-1206s1c1
Sequence:CCGGGAGACAGAGATCGTGAAAGAACTCGAGTTCTTTCACGATCTCTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144681.1-428s1c1
Sequence:CCGGCAGAATGGAAACCCTGAACCTCTCGAGAGGTTCAGGGTTTCCATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128422    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144681.1-665s1c1
Sequence:CCGGGAAGGACTACTACATCTTCAACTCGAGTTGAAGATGTAGTAGTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144681.1-389s1c1
Sequence:CCGGGCATCAAACTATGGTGCAGAACTCGAGTTCTGCACCATAGTTTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131025    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144681.1-1203s1c1
Sequence:CCGGCCTGAGACAGAGATCGTGAAACTCGAGTTTCACGATCTCTGTCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144681.1-925s1c1
Sequence:CCGGGCAATGTCATCTTCTGGGAATCTCGAGATTCCCAGAAGATGACATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144681
CCDC42 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 42
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000441443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144681.2-265s21c1
Sequence:CCGGAGTACTTCCGGCTGCAGTATGCTCGAGCATACTGCAGCCGGAAGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144681.2-467s21c1
Sequence:CCGGCGTTAAGGAAGCCCAACTGAACTCGAGTTCAGTTGGGCTTCCTTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144681.1-1091s1c1
Sequence:CCGGGCTGGACATGATCCAGCAATTCTCGAGAATTGCTGGATCATGTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130383    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144681.1-1206s1c1
Sequence:CCGGGAGACAGAGATCGTGAAAGAACTCGAGTTCTTTCACGATCTCTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144681.1-428s1c1
Sequence:CCGGCAGAATGGAAACCCTGAACCTCTCGAGAGGTTCAGGGTTTCCATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128422    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144681.1-665s1c1
Sequence:CCGGGAAGGACTACTACATCTTCAACTCGAGTTGAAGATGTAGTAGTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144681.1-389s1c1
Sequence:CCGGGCATCAAACTATGGTGCAGAACTCGAGTTCTGCACCATAGTTTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131025    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144681.1-1203s1c1
Sequence:CCGGCCTGAGACAGAGATCGTGAAACTCGAGTTTCACGATCTCTGTCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144681.1-925s1c1
Sequence:CCGGGCAATGTCATCTTCTGGGAATCTCGAGATTCCCAGAAGATGACATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144681
CCDC42 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 42
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000441443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144681.2-265s21c1
Sequence:CCGGAGTACTTCCGGCTGCAGTATGCTCGAGCATACTGCAGCCGGAAGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144681.2-467s21c1
Sequence:CCGGCGTTAAGGAAGCCCAACTGAACTCGAGTTCAGTTGGGCTTCCTTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144681.1-1091s1c1
Sequence:CCGGGCTGGACATGATCCAGCAATTCTCGAGAATTGCTGGATCATGTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130383    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144681.1-1206s1c1
Sequence:CCGGGAGACAGAGATCGTGAAAGAACTCGAGTTCTTTCACGATCTCTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144681.1-428s1c1
Sequence:CCGGCAGAATGGAAACCCTGAACCTCTCGAGAGGTTCAGGGTTTCCATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128422    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144681.1-665s1c1
Sequence:CCGGGAAGGACTACTACATCTTCAACTCGAGTTGAAGATGTAGTAGTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144681.1-389s1c1
Sequence:CCGGGCATCAAACTATGGTGCAGAACTCGAGTTCTGCACCATAGTTTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131025    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144681.1-1203s1c1
Sequence:CCGGCCTGAGACAGAGATCGTGAAACTCGAGTTTCACGATCTCTGTCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144681.1-925s1c1
Sequence:CCGGGCAATGTCATCTTCTGGGAATCTCGAGATTCCCAGAAGATGACATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177779
CCDC42 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 42
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000250888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177779.3-484s21c1
Sequence:CCGGGAAACGGATCCGAGCCCTAAACTCGAGTTTAGGGCTCGGATCCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177779.3-445s21c1
Sequence:CCGGTATCCAGAAGTTCGAGCAATTCTCGAGAATTGCTCGAACTTCTGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177779.3-403s21c1
Sequence:CCGGCTGGGAAGAACTAGGTATTAACTCGAGTTAATACCTAGTTCTTCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250885    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177779.3-1133s21c1
Sequence:CCGGAGTAACATGCTTCTAGAATGTCTCGAGACATTCTAGAAGCATGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177779.3-938s21c1
Sequence:CCGGCTCCTGCTTGGCACCATTAAGCTCGAGCTTAATGGTGCCAAGCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181145    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177779.2-240s1c1
Sequence:CCGGCGATGAGATTCTTCAGCACAACTCGAGTTGTGCTGAAGAATCTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181111    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177779.2-472s1c1
Sequence:CCGGCTAGACATGATCCAGCAGTTTCTCGAGAAACTGCTGGATCATGTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195781    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177779.2-424s1c1
Sequence:CCGGCAACTGAAGGAATCCACCCAACTCGAGTTGGGTGGATTCCTTCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177779
CCDC42 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 42
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000250888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177779.3-484s21c1
Sequence:CCGGGAAACGGATCCGAGCCCTAAACTCGAGTTTAGGGCTCGGATCCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177779.3-445s21c1
Sequence:CCGGTATCCAGAAGTTCGAGCAATTCTCGAGAATTGCTCGAACTTCTGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177779.3-403s21c1
Sequence:CCGGCTGGGAAGAACTAGGTATTAACTCGAGTTAATACCTAGTTCTTCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250885    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177779.3-1133s21c1
Sequence:CCGGAGTAACATGCTTCTAGAATGTCTCGAGACATTCTAGAAGCATGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177779.3-938s21c1
Sequence:CCGGCTCCTGCTTGGCACCATTAAGCTCGAGCTTAATGGTGCCAAGCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181145    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177779.2-240s1c1
Sequence:CCGGCGATGAGATTCTTCAGCACAACTCGAGTTGTGCTGAAGAATCTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181111    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177779.2-472s1c1
Sequence:CCGGCTAGACATGATCCAGCAGTTTCTCGAGAAACTGCTGGATCATGTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195781    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177779.2-424s1c1
Sequence:CCGGCAACTGAAGGAATCCACCCAACTCGAGTTGGGTGGATTCCTTCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177779
CCDC42 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 42
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000250888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177779.3-484s21c1
Sequence:CCGGGAAACGGATCCGAGCCCTAAACTCGAGTTTAGGGCTCGGATCCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177779.3-445s21c1
Sequence:CCGGTATCCAGAAGTTCGAGCAATTCTCGAGAATTGCTCGAACTTCTGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177779.3-403s21c1
Sequence:CCGGCTGGGAAGAACTAGGTATTAACTCGAGTTAATACCTAGTTCTTCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250885    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177779.3-1133s21c1
Sequence:CCGGAGTAACATGCTTCTAGAATGTCTCGAGACATTCTAGAAGCATGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177779.3-938s21c1
Sequence:CCGGCTCCTGCTTGGCACCATTAAGCTCGAGCTTAATGGTGCCAAGCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181145    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177779.2-240s1c1
Sequence:CCGGCGATGAGATTCTTCAGCACAACTCGAGTTGTGCTGAAGAATCTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181111    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177779.2-472s1c1
Sequence:CCGGCTAGACATGATCCAGCAGTTTCTCGAGAAACTGCTGGATCATGTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195781    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177779.2-424s1c1
Sequence:CCGGCAACTGAAGGAATCCACCCAACTCGAGTTGGGTGGATTCCTTCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks