EMAIL THIS PAGE TO A FRIEND

CCDC42B

coiled-coil domain containing 42B

78 Gene Product Result for
UniProtKB ID: A6NFT4
Gene ID:
Mouse(546886) coiled-coil domain containing 42B
Rat(304509) coiled-coil domain containing 42B
chicken(770540) coiled-coil domain containing 42B
domestic cat(101088881) coiled-coil domain containing 42B
cow(515855) coiled-coil domain containing 42B
dog(100683812) coiled-coil domain containing 42B
sheep(101112598) coiled-coil domain containing 42B
naked mole-rat(101726358) coiled-coil domain containing 42B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001144872 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001144872 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001144872 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001714517 Rosetta Predictions human pricing
XM_373547 Rosetta Predictions human pricing
XM_941496 Rosetta Predictions human pricing
XM_001079849 Rosetta Predictions rat pricing
XM_222198 Rosetta Predictions rat pricing
XM_001473234 Rosetta Predictions mouse pricing
XM_914849 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001714517 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00397629 predicted 683
2 SASI_Hs02_00397630 predicted 233
3 SASI_Hs02_00397631 predicted 219
4 SASI_Hs02_00397632 predicted 217
5 SASI_Hs02_00397633 predicted 221
6 SASI_Hs02_00397634 predicted 493
7 SASI_Hs02_00397635 predicted 345
8 SASI_Hs02_00397636 predicted 544
9 SASI_Hs02_00397637 predicted 479
10 SASI_Hs02_00397638 predicted 228
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_373547 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00285473 predicted 680
2 SASI_Hs01_00285474 predicted 238
3 SASI_Hs01_00285475 predicted 220
4 SASI_Hs01_00285477 predicted 214
5 SASI_Hs01_00285478 predicted 224
6 SASI_Hs01_00285479 predicted 490
7 SASI_Hs01_00285480 predicted 337
8 SASI_Hs01_00285481 predicted 536
9 SASI_Hs01_00285482 predicted 481
10 SASI_Hs02_00479551 predicted 235
11 SASI_Hs01_00285476 predicted 698
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_941496 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00484883 predicted 683
2 SASI_Hs02_00484884 predicted 241
3 SASI_Hs02_00484885 predicted 220
4 SASI_Hs02_00484886 predicted 210
5 SASI_Hs02_00484887 predicted 217
6 SASI_Hs02_00484888 predicted 495
7 SASI_Hs02_00484889 predicted 338
8 SASI_Hs02_00484890 predicted 535
9 SASI_Hs02_00484891 predicted 472
10 SASI_Hs02_00484892 predicted 228
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079849 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00365708 predicted 236
2 SASI_Rn02_00365709 predicted 230
3 SASI_Rn02_00365710 predicted 701
4 SASI_Rn02_00365711 predicted 318
5 SASI_Rn02_00365712 predicted 707
6 SASI_Rn02_00365713 predicted 639
7 SASI_Rn02_00365714 predicted 711
8 SASI_Rn02_00365715 predicted 212
9 SASI_Rn02_00365716 predicted 714
10 SASI_Rn02_00365717 predicted 208
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_222198 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00380625 predicted 1153
2 SASI_Rn02_00380626 predicted 960
3 SASI_Rn02_00380627 predicted 1146
4 SASI_Rn02_00380628 predicted 1084
5 SASI_Rn02_00380629 predicted 1151
6 SASI_Rn02_00380630 predicted 1151
7 SASI_Rn02_00380631 predicted 1007
8 SASI_Rn02_00380632 predicted 1154
9 SASI_Rn02_00380633 predicted 1101
10 SASI_Rn02_00380634 predicted 995
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001473234 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00366848 predicted 680
2 SASI_Mm02_00366849 predicted 294
3 SASI_Mm02_00366850 predicted 452
4 SASI_Mm02_00366851 predicted 681
5 SASI_Mm02_00366852 predicted 669
6 SASI_Mm02_00366853 predicted 594
7 SASI_Mm02_00366854 predicted 225
8 SASI_Mm02_00366855 predicted 333
9 SASI_Mm02_00366856 predicted 571
10 SASI_Mm02_00366857 predicted 689
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_914849 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00438953 predicted 680
2 SASI_Mm02_00438954 predicted 290
3 SASI_Mm02_00438955 predicted 449
4 SASI_Mm02_00438956 predicted 678
5 SASI_Mm02_00438957 predicted 665
6 SASI_Mm02_00438958 predicted 597
7 SASI_Mm02_00438959 predicted 225
8 SASI_Mm02_00438960 predicted 331
9 SASI_Mm02_00438961 predicted 566
10 SASI_Mm02_00438962 predicted 693
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001144872
CCDC42B MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 42B
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438359    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001144872.1-1115s21c1
Sequence:CCGGTCACATCCTCTTCCGCATCTTCTCGAGAAGATGCGGAAGAGGATGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434483    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001144872.1-1072s21c1
Sequence:CCGGACCCTAAGGCCAATCAAGGAGCTCGAGCTCCTTGATTGGCCTTAGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144872.1-186s21c1
Sequence:CCAGCCTGAAACAGCGTTGGGAACACTCGAGTGTTCCCAACGCTGTTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144872.1-684s21c1
Sequence:CCGGGCAGTGGGAATCCAAGTGGATCTCGAGATCCACTTGGATTCCCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144872.1-233s21c1
Sequence:CCGGAGGGATCGTTCATCCGCTTTGCTCGAGCAAAGCGGATGAACGATCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144872.1-845s21c1
Sequence:CCGGAGCACGTGAAGCTGTTCATGCCTCGAGGCATGAACAGCTTCACGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144872.1-27s21c1
Sequence:CCGGCCGACTGGCTTTGCAAGAGAACTCGAGTTCTCTTGCAAAGCCAGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144872.1-754s21c1
Sequence:CCGGAGGATGGCTGTGCTCAACCTGCTCGAGCAGGTTGAGCACAGCCATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144872.1-40s21c1
Sequence:CCGGCAAGAGAAACTGTCTACAAAGCTCGAGCTTTGTAGACAGTTTCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144872.1-834s21c1
Sequence:CCGGGGGACAGCTAGAGCACGTGAACTCGAGTTCACGTGCTCTAGCTGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144872.1-117s21c1
Sequence:CCGGGCAAGAGCTGGTAGATGCAGACTCGAGTCTGCATCTACCAGCTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001144872
CCDC42B MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 42B
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438359    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001144872.1-1115s21c1
Sequence:CCGGTCACATCCTCTTCCGCATCTTCTCGAGAAGATGCGGAAGAGGATGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434483    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001144872.1-1072s21c1
Sequence:CCGGACCCTAAGGCCAATCAAGGAGCTCGAGCTCCTTGATTGGCCTTAGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144872.1-186s21c1
Sequence:CCAGCCTGAAACAGCGTTGGGAACACTCGAGTGTTCCCAACGCTGTTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144872.1-684s21c1
Sequence:CCGGGCAGTGGGAATCCAAGTGGATCTCGAGATCCACTTGGATTCCCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144872.1-233s21c1
Sequence:CCGGAGGGATCGTTCATCCGCTTTGCTCGAGCAAAGCGGATGAACGATCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144872.1-845s21c1
Sequence:CCGGAGCACGTGAAGCTGTTCATGCCTCGAGGCATGAACAGCTTCACGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144872.1-27s21c1
Sequence:CCGGCCGACTGGCTTTGCAAGAGAACTCGAGTTCTCTTGCAAAGCCAGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144872.1-754s21c1
Sequence:CCGGAGGATGGCTGTGCTCAACCTGCTCGAGCAGGTTGAGCACAGCCATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144872.1-40s21c1
Sequence:CCGGCAAGAGAAACTGTCTACAAAGCTCGAGCTTTGTAGACAGTTTCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144872.1-834s21c1
Sequence:CCGGGGGACAGCTAGAGCACGTGAACTCGAGTTCACGTGCTCTAGCTGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144872.1-117s21c1
Sequence:CCGGGCAAGAGCTGGTAGATGCAGACTCGAGTCTGCATCTACCAGCTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001144872
CCDC42B MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 42B
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438359    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001144872.1-1115s21c1
Sequence:CCGGTCACATCCTCTTCCGCATCTTCTCGAGAAGATGCGGAAGAGGATGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434483    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001144872.1-1072s21c1
Sequence:CCGGACCCTAAGGCCAATCAAGGAGCTCGAGCTCCTTGATTGGCCTTAGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144872.1-186s21c1
Sequence:CCAGCCTGAAACAGCGTTGGGAACACTCGAGTGTTCCCAACGCTGTTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144872.1-684s21c1
Sequence:CCGGGCAGTGGGAATCCAAGTGGATCTCGAGATCCACTTGGATTCCCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144872.1-233s21c1
Sequence:CCGGAGGGATCGTTCATCCGCTTTGCTCGAGCAAAGCGGATGAACGATCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144872.1-845s21c1
Sequence:CCGGAGCACGTGAAGCTGTTCATGCCTCGAGGCATGAACAGCTTCACGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144872.1-27s21c1
Sequence:CCGGCCGACTGGCTTTGCAAGAGAACTCGAGTTCTCTTGCAAAGCCAGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144872.1-754s21c1
Sequence:CCGGAGGATGGCTGTGCTCAACCTGCTCGAGCAGGTTGAGCACAGCCATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144872.1-40s21c1
Sequence:CCGGCAAGAGAAACTGTCTACAAAGCTCGAGCTTTGTAGACAGTTTCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144872.1-834s21c1
Sequence:CCGGGGGACAGCTAGAGCACGTGAACTCGAGTTCACGTGCTCTAGCTGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144872.1-117s21c1
Sequence:CCGGGCAAGAGCTGGTAGATGCAGACTCGAGTCTGCATCTACCAGCTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks