EMAIL THIS PAGE TO A FRIEND

CCDC43

coiled-coil domain containing 43

96 Gene Product Result for
UniProtKB ID: Q96MW1, C9JVK9
Gene ID:
Mouse(52715) coiled-coil domain containing 43
Rat(360637) coiled-coil domain containing 43
naked mole-rat(101712797) coiled-coil domain containing 43
domestic guinea pig(100721497) coiled-coil domain containing 43
sheep(101117433) coiled-coil domain containing 43
Zebrafish(393631) coiled-coil domain containing 43
cow(513649) coiled-coil domain containing 43
domestic cat(101101427) coiled-coil domain containing 43
dog(480498) coiled-coil domain containing 43
chicken(419971) coiled-coil domain containing 43
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA023391 Anti-CCDC43 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution rat, human, mouse
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144609 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144609 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144609 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025918 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025918 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025918 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099225 Rosetta Predictions human pricing
NM_144609 Rosetta Predictions human pricing
XM_001081522 Rosetta Predictions rat pricing
XM_340915 Rosetta Predictions rat pricing
NM_025918 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099225 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320269 predicted 841
2 SASI_Hs02_00320270 predicted 854
3 SASI_Hs02_00320271 predicted 953
4 SASI_Hs02_00320272 predicted 835
5 SASI_Hs02_00320273 predicted 937
6 SASI_Hs02_00320274 predicted 241
7 SASI_Hs02_00320275 predicted 939
8 SASI_Hs02_00320276 predicted 835
9 SASI_Hs02_00320277 predicted 949
10 SASI_Hs02_00320278 predicted 849
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144609 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00364414 predicted 895
2 SASI_Hs02_00364415 predicted 909
3 SASI_Hs02_00364416 predicted 1014
4 SASI_Hs02_00364417 predicted 895
5 SASI_Hs02_00364418 predicted 997
6 SASI_Hs01_00050918 predicted 241
7 SASI_Hs01_00050920 predicted 1004
8 SASI_Hs02_00364419 predicted 894
9 SASI_Hs01_00050921 predicted 1010
10 SASI_Hs02_00364420 predicted 907
11 SASI_Hs01_00050914 predicted 309
12 SASI_Hs01_00050915 predicted 869
13 SASI_Hs01_00050916 predicted 338
14 SASI_Hs01_00050917 predicted 408
15 SASI_Hs01_00050919 predicted 249
16 SASI_Hs01_00050922 predicted 326
17 SASI_Hs01_00050923 predicted 331
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081522 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00372271 predicted 737
2 SASI_Rn02_00372272 predicted 534
3 SASI_Rn02_00372273 predicted 913
4 SASI_Rn02_00372274 predicted 759
5 SASI_Rn02_00372275 predicted 937
6 SASI_Rn02_00372276 predicted 801
7 SASI_Rn02_00372277 predicted 1026
8 SASI_Rn02_00372278 predicted 807
9 SASI_Rn02_00372279 predicted 594
10 SASI_Rn02_00372280 predicted 789
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_340915 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00392120 predicted 734
2 SASI_Rn02_00392121 predicted 537
3 SASI_Rn02_00392122 predicted 911
4 SASI_Rn02_00392123 predicted 753
5 SASI_Rn02_00392124 predicted 942
6 SASI_Rn02_00392125 predicted 805
7 SASI_Rn02_00392126 predicted 1030
8 SASI_Rn02_00392127 predicted 805
9 SASI_Rn02_00392128 predicted 597
10 SASI_Rn02_00392129 predicted 798
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025918 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00185632 predicted 694
2 SASI_Mm01_00185633 predicted 665
3 SASI_Mm01_00185635 predicted 724
4 SASI_Mm01_00185636 predicted 218
5 SASI_Mm01_00185637 predicted 536
6 SASI_Mm01_00185638 predicted 452
7 SASI_Mm02_00329272 predicted 563
8 SASI_Mm01_00185639 predicted 676
9 SASI_Mm01_00185640 predicted 408
10 SASI_Mm01_00185641 predicted 726
11 SASI_Mm01_00185634 predicted 548
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144609
VALIDATED
CCDC43 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 43
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436074    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144609.2-1075s21c1
Sequence:CCGGATCAATCCCTCCCTGAGATAACTCGAGTTATCTCAGGGAGGGATTGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144609.2-444s21c1
Sequence:CCGGCAGTATGCTGATGTGACAGATCTCGAGATCTGTCACATCAGCATACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144609.2-527s21c1
Sequence:CCGGCAAACTTCTGTTCCGAAACACCTCGAGGTGTTTCGGAACAGAAGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144609.2-557s21c1
Sequence:CCGGAGATGTCCTTAATGCCCGAAACTCGAGTTTCGGGCATTAAGGACATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144609.2-346s21c1
Sequence:CCGGAGGCCATTGCCACCCTAATTGCTCGAGCAATTAGGGTGGCAATGGCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144609.2-251s21c1
Sequence:CCGGAGAAGATTCCCTCCTTAATATCTCGAGATATTAAGGAGGGAATCTTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144609.2-642s21c1
Sequence:CCGGGAGAGAGACAAACTAGCCAAGCTCGAGCTTGGCTAGTTTGTCTCTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144609.2-284s21c1
Sequence:CCGGTGTGGAACGATGGTCAGAAACCTCGAGGTTTCTGACCATCGTTCCACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144609.2-716s21c1
Sequence:CCGGATAACCTTGGCCTACTCTATTCTCGAGAATAGAGTAGGCCAAGGTTATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425662    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144609.2-1110s21c1
Sequence:CCGGCATTGCTTTGGAGTCAGTATTCTCGAGAATACTGACTCCAAAGCAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144609.2-499s21c1
Sequence:CCGGGTGCTACCACAATGAACATTGCTCGAGCAATGTTCATTGTGGTAGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173118    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144609.1-557s1c1
Sequence:CCGGCACTTCGGGATGAATCCCAAACTCGAGTTTGGGATTCATCCCGAAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168742    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144609.1-340s1c1
Sequence:CCGGGCACAAATCGTAGTAAAGCCACTCGAGTGGCTTTACTACGATTTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_144609.1-336s1c1
Sequence:CCGGGCAGGCACAAATCGTAGTAAACTCGAGTTTACTACGATTTGTGCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167722    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144609.1-1098s1c1
Sequence:CCGGGCTGTAAGTGTAGTATTGTTTCTCGAGAAACAATACTACACTTACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144609
VALIDATED
CCDC43 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 43
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436074    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144609.2-1075s21c1
Sequence:CCGGATCAATCCCTCCCTGAGATAACTCGAGTTATCTCAGGGAGGGATTGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144609.2-444s21c1
Sequence:CCGGCAGTATGCTGATGTGACAGATCTCGAGATCTGTCACATCAGCATACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144609.2-527s21c1
Sequence:CCGGCAAACTTCTGTTCCGAAACACCTCGAGGTGTTTCGGAACAGAAGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144609.2-557s21c1
Sequence:CCGGAGATGTCCTTAATGCCCGAAACTCGAGTTTCGGGCATTAAGGACATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144609.2-346s21c1
Sequence:CCGGAGGCCATTGCCACCCTAATTGCTCGAGCAATTAGGGTGGCAATGGCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144609.2-251s21c1
Sequence:CCGGAGAAGATTCCCTCCTTAATATCTCGAGATATTAAGGAGGGAATCTTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144609.2-642s21c1
Sequence:CCGGGAGAGAGACAAACTAGCCAAGCTCGAGCTTGGCTAGTTTGTCTCTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144609.2-284s21c1
Sequence:CCGGTGTGGAACGATGGTCAGAAACCTCGAGGTTTCTGACCATCGTTCCACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144609.2-716s21c1
Sequence:CCGGATAACCTTGGCCTACTCTATTCTCGAGAATAGAGTAGGCCAAGGTTATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425662    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144609.2-1110s21c1
Sequence:CCGGCATTGCTTTGGAGTCAGTATTCTCGAGAATACTGACTCCAAAGCAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144609.2-499s21c1
Sequence:CCGGGTGCTACCACAATGAACATTGCTCGAGCAATGTTCATTGTGGTAGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173118    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144609.1-557s1c1
Sequence:CCGGCACTTCGGGATGAATCCCAAACTCGAGTTTGGGATTCATCCCGAAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168742    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144609.1-340s1c1
Sequence:CCGGGCACAAATCGTAGTAAAGCCACTCGAGTGGCTTTACTACGATTTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_144609.1-336s1c1
Sequence:CCGGGCAGGCACAAATCGTAGTAAACTCGAGTTTACTACGATTTGTGCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167722    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144609.1-1098s1c1
Sequence:CCGGGCTGTAAGTGTAGTATTGTTTCTCGAGAAACAATACTACACTTACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144609
VALIDATED
CCDC43 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 43
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436074    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144609.2-1075s21c1
Sequence:CCGGATCAATCCCTCCCTGAGATAACTCGAGTTATCTCAGGGAGGGATTGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144609.2-444s21c1
Sequence:CCGGCAGTATGCTGATGTGACAGATCTCGAGATCTGTCACATCAGCATACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144609.2-527s21c1
Sequence:CCGGCAAACTTCTGTTCCGAAACACCTCGAGGTGTTTCGGAACAGAAGTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144609.2-557s21c1
Sequence:CCGGAGATGTCCTTAATGCCCGAAACTCGAGTTTCGGGCATTAAGGACATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144609.2-346s21c1
Sequence:CCGGAGGCCATTGCCACCCTAATTGCTCGAGCAATTAGGGTGGCAATGGCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144609.2-251s21c1
Sequence:CCGGAGAAGATTCCCTCCTTAATATCTCGAGATATTAAGGAGGGAATCTTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144609.2-642s21c1
Sequence:CCGGGAGAGAGACAAACTAGCCAAGCTCGAGCTTGGCTAGTTTGTCTCTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144609.2-284s21c1
Sequence:CCGGTGTGGAACGATGGTCAGAAACCTCGAGGTTTCTGACCATCGTTCCACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144609.2-716s21c1
Sequence:CCGGATAACCTTGGCCTACTCTATTCTCGAGAATAGAGTAGGCCAAGGTTATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425662    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144609.2-1110s21c1
Sequence:CCGGCATTGCTTTGGAGTCAGTATTCTCGAGAATACTGACTCCAAAGCAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144609.2-499s21c1
Sequence:CCGGGTGCTACCACAATGAACATTGCTCGAGCAATGTTCATTGTGGTAGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173118    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144609.1-557s1c1
Sequence:CCGGCACTTCGGGATGAATCCCAAACTCGAGTTTGGGATTCATCCCGAAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168742    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144609.1-340s1c1
Sequence:CCGGGCACAAATCGTAGTAAAGCCACTCGAGTGGCTTTACTACGATTTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_144609.1-336s1c1
Sequence:CCGGGCAGGCACAAATCGTAGTAAACTCGAGTTTACTACGATTTGTGCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167722    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144609.1-1098s1c1
Sequence:CCGGGCTGTAAGTGTAGTATTGTTTCTCGAGAAACAATACTACACTTACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025918
VALIDATED
CCDC43 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 43
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000276763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025918.3-478s21c1
Sequence:CCGGCAAACGTCAGTTCTGACAGAACTCGAGTTCTGTCAGAACTGACGTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025918.3-218s21c1
Sequence:CCGGAGAAGAGTCTCTCCTTGATATCTCGAGATATCAAGGAGAGACTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025918.3-527s21c1
Sequence:CCGGTGTTCTCAATGCTCGGAAATTCTCGAGAATTTCCGAGCATTGAGAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025918.3-423s21c1
Sequence:CCGGGTGACAGACGAAGAGGATGAACTCGAGTTCATCCTCTTCGTCTGTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276805    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025918.3-1236s21c1
Sequence:CCGGCCAGACTTTCTGACATCAAATCTCGAGATTTGATGTCAGAAAGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025918.1-424s1c1
Sequence:CCGGGTGACAGACGAAGAGGATGAACTCGAGTTCATCCTCTTCGTCTGTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191158    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025918.1-1237s1c1
Sequence:CCGGCCAGACTTTCTGACATCAAATCTCGAGATTTGATGTCAGAAAGTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200715    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025918.1-1680s1c1
Sequence:CCGGGCTGAATTTATAGCTGTCCTTCTCGAGAAGGACAGCTATAAATTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025918.1-479s1c1
Sequence:CCGGCAAACGTCAGTTCTGACAGAACTCGAGTTCTGTCAGAACTGACGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202034    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025918.1-318s1c1
Sequence:CCGGCATCGCCACCTTGATTGAGAACTCGAGTTCTCAATCAAGGTGGCGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025918.1-486s1c1
Sequence:CCGGCAGTTCTGACAGAACCTTGTTCTCGAGAACAAGGTTCTGTCAGAACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025918
VALIDATED
CCDC43 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 43
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000276763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025918.3-478s21c1
Sequence:CCGGCAAACGTCAGTTCTGACAGAACTCGAGTTCTGTCAGAACTGACGTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025918.3-218s21c1
Sequence:CCGGAGAAGAGTCTCTCCTTGATATCTCGAGATATCAAGGAGAGACTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025918.3-527s21c1
Sequence:CCGGTGTTCTCAATGCTCGGAAATTCTCGAGAATTTCCGAGCATTGAGAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025918.3-423s21c1
Sequence:CCGGGTGACAGACGAAGAGGATGAACTCGAGTTCATCCTCTTCGTCTGTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276805    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025918.3-1236s21c1
Sequence:CCGGCCAGACTTTCTGACATCAAATCTCGAGATTTGATGTCAGAAAGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025918.1-424s1c1
Sequence:CCGGGTGACAGACGAAGAGGATGAACTCGAGTTCATCCTCTTCGTCTGTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191158    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025918.1-1237s1c1
Sequence:CCGGCCAGACTTTCTGACATCAAATCTCGAGATTTGATGTCAGAAAGTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200715    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025918.1-1680s1c1
Sequence:CCGGGCTGAATTTATAGCTGTCCTTCTCGAGAAGGACAGCTATAAATTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025918.1-479s1c1
Sequence:CCGGCAAACGTCAGTTCTGACAGAACTCGAGTTCTGTCAGAACTGACGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202034    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025918.1-318s1c1
Sequence:CCGGCATCGCCACCTTGATTGAGAACTCGAGTTCTCAATCAAGGTGGCGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025918.1-486s1c1
Sequence:CCGGCAGTTCTGACAGAACCTTGTTCTCGAGAACAAGGTTCTGTCAGAACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025918
VALIDATED
CCDC43 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 43
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000276763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025918.3-478s21c1
Sequence:CCGGCAAACGTCAGTTCTGACAGAACTCGAGTTCTGTCAGAACTGACGTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025918.3-218s21c1
Sequence:CCGGAGAAGAGTCTCTCCTTGATATCTCGAGATATCAAGGAGAGACTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025918.3-527s21c1
Sequence:CCGGTGTTCTCAATGCTCGGAAATTCTCGAGAATTTCCGAGCATTGAGAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025918.3-423s21c1
Sequence:CCGGGTGACAGACGAAGAGGATGAACTCGAGTTCATCCTCTTCGTCTGTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276805    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025918.3-1236s21c1
Sequence:CCGGCCAGACTTTCTGACATCAAATCTCGAGATTTGATGTCAGAAAGTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025918.1-424s1c1
Sequence:CCGGGTGACAGACGAAGAGGATGAACTCGAGTTCATCCTCTTCGTCTGTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191158    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025918.1-1237s1c1
Sequence:CCGGCCAGACTTTCTGACATCAAATCTCGAGATTTGATGTCAGAAAGTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200715    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025918.1-1680s1c1
Sequence:CCGGGCTGAATTTATAGCTGTCCTTCTCGAGAAGGACAGCTATAAATTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025918.1-479s1c1
Sequence:CCGGCAAACGTCAGTTCTGACAGAACTCGAGTTCTGTCAGAACTGACGTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202034    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025918.1-318s1c1
Sequence:CCGGCATCGCCACCTTGATTGAGAACTCGAGTTCTCAATCAAGGTGGCGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025918.1-486s1c1
Sequence:CCGGCAGTTCTGACAGAACCTTGTTCTCGAGAACAAGGTTCTGTCAGAACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)