EMAIL THIS PAGE TO A FRIEND

CCDC47

coiled-coil domain containing 47

Synonyms: MSTP041
Gene ID:
Mouse(67163) coiled-coil domain containing 47
Rat(303606) coiled-coil domain containing 47
Zebrafish(447812) coiled-coil domain containing 47
cow(540167) coiled-coil domain containing 47
Horse(100054134) coiled-coil domain containing 47
dog(480480) coiled-coil domain containing 47
domestic cat(101096620) coiled-coil domain containing 47
chicken(419958) coiled-coil domain containing 47
sheep(101103333) coiled-coil domain containing 47
domestic guinea pig(100716345) coiled-coil domain containing 47
naked mole-rat(101710076) coiled-coil domain containing 47
162 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020198 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020198 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020198 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026009 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026009 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026009 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020198 Rosetta Predictions human pricing
NM_001013974 Rosetta Predictions rat pricing
NM_026009 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020198 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00353132 predicted 417
2 SASI_Hs01_00175594 predicted 689
3 SASI_Hs01_00175595 predicted 441
4 SASI_Hs01_00175596 predicted 1112
5 SASI_Hs01_00175597 predicted 603
6 SASI_Hs01_00175598 predicted 1308
7 SASI_Hs01_00175600 predicted 612
8 SASI_Hs01_00175601 predicted 1221
9 SASI_Hs01_00175602 predicted 1006
10 SASI_Hs01_00175603 predicted 380
11 SASI_Hs01_00175599 predicted 332
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013974 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00113422 predicted 411
2 SASI_Rn01_00113423 predicted 1045
3 SASI_Rn01_00113424 predicted 561
4 SASI_Rn01_00113426 predicted 420
5 SASI_Rn01_00113427 predicted 1489
6 SASI_Rn01_00113428 predicted 419
7 SASI_Rn01_00113429 predicted 1691
8 SASI_Rn01_00113430 predicted 488
9 SASI_Rn01_00113431 predicted 762
10 SASI_Rn02_00201311 predicted 1153
11 SASI_Rn01_00113425 predicted 448
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026009 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00198548 predicted 1544
2 SASI_Mm01_00198549 predicted 1422
3 SASI_Mm01_00198550 predicted 1203
4 SASI_Mm01_00198551 predicted 534
5 SASI_Mm01_00198552 predicted 1374
6 SASI_Mm01_00198553 predicted 1348
7 SASI_Mm01_00198555 predicted 904
8 SASI_Mm01_00198556 predicted 617
9 SASI_Mm01_00198557 predicted 731
10 SASI_Mm02_00329475 predicted 1672
11 SASI_Mm01_00198554 predicted 480
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020198
VALIDATED
CCDC47 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 47
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000167983    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020198.1-1110s1c1
Sequence:CCGGCAGACGGAATGATGGATACAACTCGAGTTGTATCCATCATTCCGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167848    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020198.1-2595s1c1
Sequence:CCGGGCCATGAATATGTGTAAGTATCTCGAGATACTTACACATATTCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020198.1-1128s1c1
Sequence:CCGGCAAAGATGGTTCACTTTCTTACTCGAGTAAGAAAGTGAACCATCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167242    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020198.1-539s1c1
Sequence:CCGGCCAATAACGATTGTTGATGTTCTCGAGAACATCAACAATCGTTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020198.1-998s1c1
Sequence:CCGGCTACAGAAAGAGATGCAGGATCTCGAGATCCTGCATCTCTTTCTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167890    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020198.1-1643s1c1
Sequence:CCGGCCCAGAGATTTGAGTTCTGATCTCGAGATCAGAACTCAAATCTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168873    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020198.1-1417s1c1
Sequence:CCGGCCGAGTAGAAGAGAACTTCTTCTCGAGAAGAAGTTCTCTTCTACTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_020198.2-1099s21c1
Sequence:CCGGGACATGGATACCTACGTATTTCTCGAGAAATACGTAGGTATCCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277599    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_020198.2-1795s21c1
Sequence:CCGGCCCAGAGATTTGAGTTCTGATCTCGAGATCAGAACTCAAATCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_020198.2-1150s21c1
Sequence:CCGGCTACAGAAAGAGATGCAGGATCTCGAGATCCTGCATCTCTTTCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_020198.2-1280s21c1
Sequence:CCGGCAAAGATGGTTCACTTTCTTACTCGAGTAAGAAAGTGAACCATCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020198
VALIDATED
CCDC47 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 47
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000167983    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020198.1-1110s1c1
Sequence:CCGGCAGACGGAATGATGGATACAACTCGAGTTGTATCCATCATTCCGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167848    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020198.1-2595s1c1
Sequence:CCGGGCCATGAATATGTGTAAGTATCTCGAGATACTTACACATATTCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020198.1-1128s1c1
Sequence:CCGGCAAAGATGGTTCACTTTCTTACTCGAGTAAGAAAGTGAACCATCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167242    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020198.1-539s1c1
Sequence:CCGGCCAATAACGATTGTTGATGTTCTCGAGAACATCAACAATCGTTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020198.1-998s1c1
Sequence:CCGGCTACAGAAAGAGATGCAGGATCTCGAGATCCTGCATCTCTTTCTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167890    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020198.1-1643s1c1
Sequence:CCGGCCCAGAGATTTGAGTTCTGATCTCGAGATCAGAACTCAAATCTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168873    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020198.1-1417s1c1
Sequence:CCGGCCGAGTAGAAGAGAACTTCTTCTCGAGAAGAAGTTCTCTTCTACTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_020198.2-1099s21c1
Sequence:CCGGGACATGGATACCTACGTATTTCTCGAGAAATACGTAGGTATCCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277599    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_020198.2-1795s21c1
Sequence:CCGGCCCAGAGATTTGAGTTCTGATCTCGAGATCAGAACTCAAATCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_020198.2-1150s21c1
Sequence:CCGGCTACAGAAAGAGATGCAGGATCTCGAGATCCTGCATCTCTTTCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_020198.2-1280s21c1
Sequence:CCGGCAAAGATGGTTCACTTTCTTACTCGAGTAAGAAAGTGAACCATCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020198
VALIDATED
CCDC47 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 47
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000167983    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020198.1-1110s1c1
Sequence:CCGGCAGACGGAATGATGGATACAACTCGAGTTGTATCCATCATTCCGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167848    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020198.1-2595s1c1
Sequence:CCGGGCCATGAATATGTGTAAGTATCTCGAGATACTTACACATATTCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020198.1-1128s1c1
Sequence:CCGGCAAAGATGGTTCACTTTCTTACTCGAGTAAGAAAGTGAACCATCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167242    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020198.1-539s1c1
Sequence:CCGGCCAATAACGATTGTTGATGTTCTCGAGAACATCAACAATCGTTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020198.1-998s1c1
Sequence:CCGGCTACAGAAAGAGATGCAGGATCTCGAGATCCTGCATCTCTTTCTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167890    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020198.1-1643s1c1
Sequence:CCGGCCCAGAGATTTGAGTTCTGATCTCGAGATCAGAACTCAAATCTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168873    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020198.1-1417s1c1
Sequence:CCGGCCGAGTAGAAGAGAACTTCTTCTCGAGAAGAAGTTCTCTTCTACTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_020198.2-1099s21c1
Sequence:CCGGGACATGGATACCTACGTATTTCTCGAGAAATACGTAGGTATCCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277599    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_020198.2-1795s21c1
Sequence:CCGGCCCAGAGATTTGAGTTCTGATCTCGAGATCAGAACTCAAATCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_020198.2-1150s21c1
Sequence:CCGGCTACAGAAAGAGATGCAGGATCTCGAGATCCTGCATCTCTTTCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_020198.2-1280s21c1
Sequence:CCGGCAAAGATGGTTCACTTTCTTACTCGAGTAAGAAAGTGAACCATCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026009
VALIDATED
CCDC47 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 47
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183696    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026009.1-258s1c1
Sequence:CCGGGAAGACATAGTAGAGTATGATCTCGAGATCATACTCTACTATGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184653    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026009.1-980s1c1
Sequence:CCGGGCTGCGACTACAGAAAGAGATCTCGAGATCTCTTTCTGTAGTCGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026009.2-1307s21c1
Sequence:CCGGGACGCTACTGTTTACATTTAACTCGAGTTAAATGTAAACAGTAGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026009.2-1113s21c1
Sequence:CCGGTATGGACTGCCAGACTCTTTGCTCGAGCAAAGAGTCTGGCAGTCCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257757    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026009.2-2073s21c1
Sequence:CCGGTCTAAACCAAGACCCTAATATCTCGAGATATTAGGGTCTTGGTTTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026009.2-958s21c1
Sequence:CCGGTGAGTGATCAAGTGCAAATAACTCGAGTTATTTGCACTTGATCACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026009.2-911s21c1
Sequence:CCGGTAAGAGACAAGACTTACTTAACTCGAGTTAAGTAAGTCTTGTCTCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026009
VALIDATED
CCDC47 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 47
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183696    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026009.1-258s1c1
Sequence:CCGGGAAGACATAGTAGAGTATGATCTCGAGATCATACTCTACTATGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184653    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026009.1-980s1c1
Sequence:CCGGGCTGCGACTACAGAAAGAGATCTCGAGATCTCTTTCTGTAGTCGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026009.2-1307s21c1
Sequence:CCGGGACGCTACTGTTTACATTTAACTCGAGTTAAATGTAAACAGTAGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026009.2-1113s21c1
Sequence:CCGGTATGGACTGCCAGACTCTTTGCTCGAGCAAAGAGTCTGGCAGTCCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257757    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026009.2-2073s21c1
Sequence:CCGGTCTAAACCAAGACCCTAATATCTCGAGATATTAGGGTCTTGGTTTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026009.2-958s21c1
Sequence:CCGGTGAGTGATCAAGTGCAAATAACTCGAGTTATTTGCACTTGATCACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026009.2-911s21c1
Sequence:CCGGTAAGAGACAAGACTTACTTAACTCGAGTTAAGTAAGTCTTGTCTCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026009
VALIDATED
CCDC47 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 47
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183696    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026009.1-258s1c1
Sequence:CCGGGAAGACATAGTAGAGTATGATCTCGAGATCATACTCTACTATGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184653    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026009.1-980s1c1
Sequence:CCGGGCTGCGACTACAGAAAGAGATCTCGAGATCTCTTTCTGTAGTCGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026009.2-1307s21c1
Sequence:CCGGGACGCTACTGTTTACATTTAACTCGAGTTAAATGTAAACAGTAGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026009.2-1113s21c1
Sequence:CCGGTATGGACTGCCAGACTCTTTGCTCGAGCAAAGAGTCTGGCAGTCCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257757    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026009.2-2073s21c1
Sequence:CCGGTCTAAACCAAGACCCTAATATCTCGAGATATTAGGGTCTTGGTTTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026009.2-958s21c1
Sequence:CCGGTGAGTGATCAAGTGCAAATAACTCGAGTTATTTGCACTTGATCACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026009.2-911s21c1
Sequence:CCGGTAAGAGACAAGACTTACTTAACTCGAGTTAAGTAAGTCTTGTCTCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks