EMAIL THIS PAGE TO A FRIEND

CCDC51

coiled-coil domain containing 51

73 Gene Product Result for
UniProtKB ID: Q96ER9, Q9HA01
Gene ID:
Mouse(66658) coiled-coil domain containing 51
Rat(316008) coiled-coil domain containing 51
domestic guinea pig(100724597) coiled-coil domain containing 51
naked mole-rat(101712758) coiled-coil domain containing 51
sheep(101111750) coiled-coil domain containing 51
Zebrafish(751752) coiled-coil domain containing 51
chicken(416045) coiled-coil domain containing 51
dog(609083) coiled-coil domain containing 51
cow(517515) coiled-coil domain containing 51
Horse(100063856) coiled-coil domain containing 51
domestic cat(101087645) coiled-coil domain containing 51
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024661 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024661 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024661 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025689 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025689 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025689 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024661 Rosetta Predictions human pricing
NM_001014098 Rosetta Predictions rat pricing
NM_025689 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024661 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00111258 predicted 1228
2 SASI_Hs01_00111261 predicted 1152
3 SASI_Hs01_00111262 predicted 280
4 SASI_Hs01_00111263 predicted 915
5 SASI_Hs01_00111264 predicted 841
6 SASI_Hs01_00111265 predicted 270
7 SASI_Hs01_00111266 predicted 688
8 SASI_Hs01_00111267 predicted 944
9 SASI_Hs02_00357062 predicted 755
10 SASI_Hs02_00357063 predicted 1134
11 SASI_Hs01_00111259 predicted 271
12 SASI_Hs01_00111260 predicted 969
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014098 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00047054 predicted 744
2 SASI_Rn01_00047055 predicted 306
3 SASI_Rn01_00047056 predicted 626
4 SASI_Rn01_00047057 predicted 1257
5 SASI_Rn01_00047058 predicted 574
6 SASI_Rn01_00047059 predicted 812
7 SASI_Rn01_00047060 predicted 307
8 SASI_Rn01_00047061 predicted 822
9 SASI_Rn01_00047062 predicted 811
10 SASI_Rn02_00201535 predicted 985
11 SASI_Rn01_00047063 predicted 577
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025689 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00328837 predicted 876
2 SASI_Mm02_00328838 predicted 536
3 SASI_Mm01_00065599 predicted 711
4 SASI_Mm01_00065600 predicted 684
5 SASI_Mm01_00065602 predicted 502
6 SASI_Mm02_00328839 predicted 814
7 SASI_Mm01_00065604 predicted 859
8 SASI_Mm02_00328840 predicted 457
9 SASI_Mm01_00065605 predicted 536
10 SASI_Mm02_00328841 predicted 882
11 SASI_Mm01_00065598 predicted 776
12 SASI_Mm01_00065601 predicted 537
13 SASI_Mm01_00065603 predicted 277
14 SASI_Mm01_00065606 predicted 926
15 SASI_Mm01_00065607 predicted 1158
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024661
VALIDATED
CCDC51 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 51
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000140885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_024661.2-926s1c1
Sequence:CCGGGCCTTGAAAGAGCAGCTTAGTCTCGAGACTAAGCTGCTCTTTCAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_024661.2-1162s1c1
Sequence:CCGGCCAAGTCAACAGGAACACCATCTCGAGATGGTGTTCCTGTTGACTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_024661.2-940s1c1
Sequence:CCGGGCTTAGTCATTCCAGGCAAGTCTCGAGACTTGCCTGGAATGACTAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139124    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024661.2-938s1c1
Sequence:CCGGCAGCTTAGTCATTCCAGGCAACTCGAGTTGCCTGGAATGACTAAGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121662    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024661.2-1288s1c1
Sequence:CCGGGCAATAGCTGTGAATGTGGATCTCGAGATCCACATTCACAGCTATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145256    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_024661.2-1294s1c1
Sequence:CCGGGCTGTGAATGTGGATTTAAGTCTCGAGACTTAAATCCACATTCACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_024661.2-1229s1c1
Sequence:CCGGGTGCTCTACATGCTATTCAAACTCGAGTTTGAATAGCATGTAGAGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_024661.3-936s21c1
Sequence:CCGGGCCTTGAAAGAGCAGCTTAGTCTCGAGACTAAGCTGCTCTTTCAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280933    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024661.3-1304s21c1
Sequence:CCGGGCTGTGAATGTGGATTTAAGTCTCGAGACTTAAATCCACATTCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024661.3-950s21c1
Sequence:CCGGGCTTAGTCATTCCAGGCAAGTCTCGAGACTTGCCTGGAATGACTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_024661.3-1172s21c1
Sequence:CCGGCCAAGTCAACAGGAACACCATCTCGAGATGGTGTTCCTGTTGACTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024661
VALIDATED
CCDC51 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 51
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000140885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_024661.2-926s1c1
Sequence:CCGGGCCTTGAAAGAGCAGCTTAGTCTCGAGACTAAGCTGCTCTTTCAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_024661.2-1162s1c1
Sequence:CCGGCCAAGTCAACAGGAACACCATCTCGAGATGGTGTTCCTGTTGACTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_024661.2-940s1c1
Sequence:CCGGGCTTAGTCATTCCAGGCAAGTCTCGAGACTTGCCTGGAATGACTAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139124    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024661.2-938s1c1
Sequence:CCGGCAGCTTAGTCATTCCAGGCAACTCGAGTTGCCTGGAATGACTAAGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121662    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024661.2-1288s1c1
Sequence:CCGGGCAATAGCTGTGAATGTGGATCTCGAGATCCACATTCACAGCTATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145256    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_024661.2-1294s1c1
Sequence:CCGGGCTGTGAATGTGGATTTAAGTCTCGAGACTTAAATCCACATTCACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_024661.2-1229s1c1
Sequence:CCGGGTGCTCTACATGCTATTCAAACTCGAGTTTGAATAGCATGTAGAGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_024661.3-936s21c1
Sequence:CCGGGCCTTGAAAGAGCAGCTTAGTCTCGAGACTAAGCTGCTCTTTCAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280933    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024661.3-1304s21c1
Sequence:CCGGGCTGTGAATGTGGATTTAAGTCTCGAGACTTAAATCCACATTCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024661.3-950s21c1
Sequence:CCGGGCTTAGTCATTCCAGGCAAGTCTCGAGACTTGCCTGGAATGACTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_024661.3-1172s21c1
Sequence:CCGGCCAAGTCAACAGGAACACCATCTCGAGATGGTGTTCCTGTTGACTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024661
VALIDATED
CCDC51 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 51
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000140885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_024661.2-926s1c1
Sequence:CCGGGCCTTGAAAGAGCAGCTTAGTCTCGAGACTAAGCTGCTCTTTCAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_024661.2-1162s1c1
Sequence:CCGGCCAAGTCAACAGGAACACCATCTCGAGATGGTGTTCCTGTTGACTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_024661.2-940s1c1
Sequence:CCGGGCTTAGTCATTCCAGGCAAGTCTCGAGACTTGCCTGGAATGACTAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139124    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024661.2-938s1c1
Sequence:CCGGCAGCTTAGTCATTCCAGGCAACTCGAGTTGCCTGGAATGACTAAGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121662    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024661.2-1288s1c1
Sequence:CCGGGCAATAGCTGTGAATGTGGATCTCGAGATCCACATTCACAGCTATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145256    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_024661.2-1294s1c1
Sequence:CCGGGCTGTGAATGTGGATTTAAGTCTCGAGACTTAAATCCACATTCACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_024661.2-1229s1c1
Sequence:CCGGGTGCTCTACATGCTATTCAAACTCGAGTTTGAATAGCATGTAGAGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_024661.3-936s21c1
Sequence:CCGGGCCTTGAAAGAGCAGCTTAGTCTCGAGACTAAGCTGCTCTTTCAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280933    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024661.3-1304s21c1
Sequence:CCGGGCTGTGAATGTGGATTTAAGTCTCGAGACTTAAATCCACATTCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024661.3-950s21c1
Sequence:CCGGGCTTAGTCATTCCAGGCAAGTCTCGAGACTTGCCTGGAATGACTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_024661.3-1172s21c1
Sequence:CCGGCCAAGTCAACAGGAACACCATCTCGAGATGGTGTTCCTGTTGACTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025689
VALIDATED
CCDC51 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 51
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025689.3-486s21c1
Sequence:CCGGTGCGGGAGAGTCATGAGAAAGCTCGAGCTTTCTCATGACTCTCCCGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025689.3-675s21c1
Sequence:CCGGGTGAACAGGCTTCTAGCTATTCTCGAGAATAGCTAGAAGCCTGTTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025689.3-577s21c1
Sequence:CCGGGGCCGGTTCCACCTATGTTAACTCGAGTTAACATAGGTGGAACCGGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025689.3-407s21c1
Sequence:CCGGGAAGAGAAGAGGCTCCGAATACTCGAGTATTCGGAGCCTCTTCTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025689.3-846s21c1
Sequence:CCGGGTCATTCCAGGCAGGTCTATTCTCGAGAATAGACCTGCCTGGAATGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025689
VALIDATED
CCDC51 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 51
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025689.3-486s21c1
Sequence:CCGGTGCGGGAGAGTCATGAGAAAGCTCGAGCTTTCTCATGACTCTCCCGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025689.3-675s21c1
Sequence:CCGGGTGAACAGGCTTCTAGCTATTCTCGAGAATAGCTAGAAGCCTGTTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025689.3-577s21c1
Sequence:CCGGGGCCGGTTCCACCTATGTTAACTCGAGTTAACATAGGTGGAACCGGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025689.3-407s21c1
Sequence:CCGGGAAGAGAAGAGGCTCCGAATACTCGAGTATTCGGAGCCTCTTCTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025689.3-846s21c1
Sequence:CCGGGTCATTCCAGGCAGGTCTATTCTCGAGAATAGACCTGCCTGGAATGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025689
VALIDATED
CCDC51 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 51
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025689.3-486s21c1
Sequence:CCGGTGCGGGAGAGTCATGAGAAAGCTCGAGCTTTCTCATGACTCTCCCGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025689.3-675s21c1
Sequence:CCGGGTGAACAGGCTTCTAGCTATTCTCGAGAATAGCTAGAAGCCTGTTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025689.3-577s21c1
Sequence:CCGGGGCCGGTTCCACCTATGTTAACTCGAGTTAACATAGGTGGAACCGGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025689.3-407s21c1
Sequence:CCGGGAAGAGAAGAGGCTCCGAATACTCGAGTATTCGGAGCCTCTTCTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025689.3-846s21c1
Sequence:CCGGGTCATTCCAGGCAGGTCTATTCTCGAGAATAGACCTGCCTGGAATGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)