EMAIL THIS PAGE TO A FRIEND

CCDC53

coiled-coil domain containing 53

89 Gene Product Result for
Synonyms: CGI-116
UniProtKB ID: Q9Y3C0, B2RC74, Q53FF0, Q6IAI4, Q96QK0
Gene ID:
Mouse(67282) coiled-coil domain containing 53
Rat(299707) coiled-coil domain containing 53
Zebrafish(393142) coiled-coil domain containing 53
chicken(418094) coiled-coil domain containing 53
dog(475444) coiled-coil domain containing 53
cow(613720) coiled-coil domain containing 53
domestic cat(101100491) coiled-coil domain containing 53
sheep(101109346) coiled-coil domain containing 53
naked mole-rat(101709358) coiled-coil domain containing 53
domestic guinea pig(100723671) coiled-coil domain containing 53
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026070 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026070 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026070 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016053 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016053 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016053 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016053 Rosetta Predictions human pricing
NM_001106776 Rosetta Predictions rat pricing
NM_001122960 Rosetta Predictions mouse pricing
NM_026070 Rosetta Predictions mouse pricing
NM_027487 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016053 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079739 predicted 470
2 SASI_Hs01_00079740 predicted 591
3 SASI_Hs01_00079741 predicted 594
4 SASI_Hs01_00079742 predicted 469
5 SASI_Hs01_00079743 predicted 593
6 SASI_Hs01_00079744 predicted 300
7 SASI_Hs01_00079745 predicted 334
8 SASI_Hs01_00079747 predicted 495
9 SASI_Hs01_00079748 predicted 425
10 SASI_Hs02_00348779 predicted 549
11 SASI_Hs01_00079746 predicted 453
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106776 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00222288 predicted 419
2 SASI_Rn02_00222289 predicted 391
3 SASI_Rn02_00222290 predicted 325
4 SASI_Rn02_00222291 predicted 595
5 SASI_Rn02_00222292 predicted 290
6 SASI_Rn02_00222293 predicted 723
7 SASI_Rn02_00222294 predicted 614
8 SASI_Rn02_00222295 predicted 544
9 SASI_Rn02_00222296 predicted 815
10 SASI_Rn02_00222297 predicted 556
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122960 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00309679 predicted 217
2 SASI_Mm02_00309680 predicted 223
3 SASI_Mm02_00309681 predicted 228
4 SASI_Mm02_00309682 predicted 216
5 SASI_Mm02_00309683 predicted 795
6 SASI_Mm02_00309684 predicted 754
7 SASI_Mm02_00309685 predicted 241
8 SASI_Mm02_00309686 predicted 804
9 SASI_Mm02_00309687 predicted 810
10 SASI_Mm02_00309688 predicted 789
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026070 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00329618 predicted 217
2 SASI_Mm02_00329619 predicted 219
3 SASI_Mm02_00329620 predicted 224
4 SASI_Mm02_00329621 predicted 216
5 SASI_Mm02_00329622 predicted 799
6 SASI_Mm02_00329623 predicted 760
7 SASI_Mm02_00329624 predicted 240
8 SASI_Mm02_00329625 predicted 804
9 SASI_Mm01_00074455 predicted 814
10 SASI_Mm02_00329626 predicted 790
11 SASI_Mm01_00074450 predicted 612
12 SASI_Mm01_00074451 predicted 505
13 SASI_Mm01_00074452 predicted 799
14 SASI_Mm01_00074453 predicted 303
15 SASI_Mm01_00074454 predicted 555
16 SASI_Mm01_00074456 predicted 692
17 SASI_Mm01_00074457 predicted 604
18 SASI_Mm01_00074458 predicted 673
19 SASI_Mm01_00074459 predicted 398
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027487 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00332297 predicted 219
2 SASI_Mm02_00332298 predicted 297
3 SASI_Mm02_00332299 predicted 283
4 SASI_Mm02_00332300 predicted 217
5 SASI_Mm02_00332301 predicted 255
6 SASI_Mm02_00332302 predicted 210
7 SASI_Mm02_00332303 predicted 309
8 SASI_Mm02_00332304 predicted 294
9 SASI_Mm02_00332305 predicted 304
10 SASI_Mm02_00332306 predicted 294
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026070
VALIDATED
CCDC53 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 53
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000424333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026070.3-542s21c1
Sequence:CCGGGATCCACGGTATGCCAGATACCTCGAGGTATCTGGCATACCGTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412633    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026070.3-796s21c1
Sequence:CCGGTATCTAGCTCTCCGTGATAAACTCGAGTTTATCACGGAGAGCTAGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026070.1-449s1c1
Sequence:CCGGCTGAAACCACTTCGGAGCAAACTCGAGTTTGCTCCGAAGTGGTTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177086    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026070.1-902s1c1
Sequence:CCGGCAATATGGTTTGTTGACCAAACTCGAGTTTGGTCAACAAACCATATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026070.1-434s1c1
Sequence:CCGGCAAACGGATCACATTCTGAAACTCGAGTTTCAGAATGTGATCCGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026070.1-679s1c1
Sequence:CCGGGAAAGCGAAAGAGCCGTAGAACTCGAGTTCTACGGCTCTTTCGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026070.1-692s1c1
Sequence:CCGGCCGTAGAAGAAAGTTCAGATACTCGAGTATCTGAACTTTCTTCTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026070
VALIDATED
CCDC53 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 53
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000424333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026070.3-542s21c1
Sequence:CCGGGATCCACGGTATGCCAGATACCTCGAGGTATCTGGCATACCGTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412633    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026070.3-796s21c1
Sequence:CCGGTATCTAGCTCTCCGTGATAAACTCGAGTTTATCACGGAGAGCTAGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026070.1-449s1c1
Sequence:CCGGCTGAAACCACTTCGGAGCAAACTCGAGTTTGCTCCGAAGTGGTTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177086    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026070.1-902s1c1
Sequence:CCGGCAATATGGTTTGTTGACCAAACTCGAGTTTGGTCAACAAACCATATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026070.1-434s1c1
Sequence:CCGGCAAACGGATCACATTCTGAAACTCGAGTTTCAGAATGTGATCCGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026070.1-679s1c1
Sequence:CCGGGAAAGCGAAAGAGCCGTAGAACTCGAGTTCTACGGCTCTTTCGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026070.1-692s1c1
Sequence:CCGGCCGTAGAAGAAAGTTCAGATACTCGAGTATCTGAACTTTCTTCTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026070
VALIDATED
CCDC53 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 53
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000424333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026070.3-542s21c1
Sequence:CCGGGATCCACGGTATGCCAGATACCTCGAGGTATCTGGCATACCGTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412633    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026070.3-796s21c1
Sequence:CCGGTATCTAGCTCTCCGTGATAAACTCGAGTTTATCACGGAGAGCTAGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026070.1-449s1c1
Sequence:CCGGCTGAAACCACTTCGGAGCAAACTCGAGTTTGCTCCGAAGTGGTTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177086    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026070.1-902s1c1
Sequence:CCGGCAATATGGTTTGTTGACCAAACTCGAGTTTGGTCAACAAACCATATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026070.1-434s1c1
Sequence:CCGGCAAACGGATCACATTCTGAAACTCGAGTTTCAGAATGTGATCCGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026070.1-679s1c1
Sequence:CCGGGAAAGCGAAAGAGCCGTAGAACTCGAGTTCTACGGCTCTTTCGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026070.1-692s1c1
Sequence:CCGGCCGTAGAAGAAAGTTCAGATACTCGAGTATCTGAACTTTCTTCTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016053
VALIDATED
CCDC53 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 53
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000330097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016053.2-506s21c1
Sequence:CCGGGACTACAGGAAAGTGAAGTATCTCGAGATACTTCACTTTCCTGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016053.2-596s21c1
Sequence:CCGGGTGTACCAGTGATGGCAATAACTCGAGTTATTGCCATCACTGGTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016053.2-397s21c1
Sequence:CCGGGATGATGTCACAGTTGAAGTACTCGAGTACTTCAACTGTGACATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016053.2-556s21c1
Sequence:CCGGGATCCAAGATATGCCAGATATCTCGAGATATCTGGCATATCTTGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016053.1-345s1c1
Sequence:CCGGGATGATGTCACAGTTGAAGTACTCGAGTACTTCAACTGTGACATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_016053.1-342s1c1
Sequence:CCGGCTAGATGATGTCACAGTTGAACTCGAGTTCAACTGTGACATCATCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016053.1-454s1c1
Sequence:CCGGGACTACAGGAAAGTGAAGTATCTCGAGATACTTCACTTTCCTGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016053.1-654s1c1
Sequence:CCGGGAAGAAAGTTCAGATAGCGAACTCGAGTTCGCTATCTGAACTTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016053
VALIDATED
CCDC53 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 53
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000330097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016053.2-506s21c1
Sequence:CCGGGACTACAGGAAAGTGAAGTATCTCGAGATACTTCACTTTCCTGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016053.2-596s21c1
Sequence:CCGGGTGTACCAGTGATGGCAATAACTCGAGTTATTGCCATCACTGGTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016053.2-397s21c1
Sequence:CCGGGATGATGTCACAGTTGAAGTACTCGAGTACTTCAACTGTGACATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016053.2-556s21c1
Sequence:CCGGGATCCAAGATATGCCAGATATCTCGAGATATCTGGCATATCTTGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016053.1-345s1c1
Sequence:CCGGGATGATGTCACAGTTGAAGTACTCGAGTACTTCAACTGTGACATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_016053.1-342s1c1
Sequence:CCGGCTAGATGATGTCACAGTTGAACTCGAGTTCAACTGTGACATCATCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016053.1-454s1c1
Sequence:CCGGGACTACAGGAAAGTGAAGTATCTCGAGATACTTCACTTTCCTGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016053.1-654s1c1
Sequence:CCGGGAAGAAAGTTCAGATAGCGAACTCGAGTTCGCTATCTGAACTTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016053
VALIDATED
CCDC53 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 53
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000330097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016053.2-506s21c1
Sequence:CCGGGACTACAGGAAAGTGAAGTATCTCGAGATACTTCACTTTCCTGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016053.2-596s21c1
Sequence:CCGGGTGTACCAGTGATGGCAATAACTCGAGTTATTGCCATCACTGGTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016053.2-397s21c1
Sequence:CCGGGATGATGTCACAGTTGAAGTACTCGAGTACTTCAACTGTGACATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016053.2-556s21c1
Sequence:CCGGGATCCAAGATATGCCAGATATCTCGAGATATCTGGCATATCTTGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016053.1-345s1c1
Sequence:CCGGGATGATGTCACAGTTGAAGTACTCGAGTACTTCAACTGTGACATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_016053.1-342s1c1
Sequence:CCGGCTAGATGATGTCACAGTTGAACTCGAGTTCAACTGTGACATCATCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016053.1-454s1c1
Sequence:CCGGGACTACAGGAAAGTGAAGTATCTCGAGATACTTCACTTTCCTGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016053.1-654s1c1
Sequence:CCGGGAAGAAAGTTCAGATAGCGAACTCGAGTTCGCTATCTGAACTTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks