EMAIL THIS PAGE TO A FRIEND

CCDC54

coiled-coil domain containing 54

59 Gene Product Result for
Synonyms: NYD-SP17 SP17
UniProtKB ID: Q8NEL0, Q96A43
Gene ID:
Mouse(69339) coiled-coil domain containing 54
Rat(498073) coiled-coil domain containing 54
domestic guinea pig(100721884) coiled-coil domain containing 54
naked mole-rat(101715962) coiled-coil domain containing 54
sheep(101114916) coiled-coil domain containing 54
dog(606816) coiled-coil domain containing 54
domestic cat(101080318) coiled-coil domain containing 54
cow(100125920) coiled-coil domain containing 54
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1303386 ANTI-CCDC54 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing
SAB2103304 Anti-CCDC54, (N-terminal) antibody produced in rabbit affinity isolated antibody human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032600 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032600 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032600 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027046 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027046 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027046 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU025111 MISSION® esiRNA esiRNA human CCDC54 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032600 Rosetta Predictions human pricing
XM_001063933 Rosetta Predictions rat pricing
XM_573274 Rosetta Predictions rat pricing
NM_027046 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032600 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00360140 predicted 970
2 SASI_Hs02_00360141 predicted 595
3 SASI_Hs02_00360142 predicted 681
4 SASI_Hs02_00360143 predicted 640
5 SASI_Hs02_00360144 predicted 694
6 SASI_Hs01_00066401 predicted 409
7 SASI_Hs01_00066402 predicted 361
8 SASI_Hs02_00360145 predicted 568
9 SASI_Hs02_00360146 predicted 443
10 SASI_Hs02_00360147 predicted 383
11 SASI_Hs01_00066397 predicted 319
12 SASI_Hs01_00066398 predicted 382
13 SASI_Hs01_00066399 predicted 1034
14 SASI_Hs01_00066400 predicted 376
15 SASI_Hs01_00066403 predicted 979
16 SASI_Hs01_00066404 predicted 294
17 SASI_Hs01_00066405 predicted 316
18 SASI_Hs01_00066406 predicted 387
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063933 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00308785 predicted 324
2 SASI_Rn02_00308786 predicted 317
3 SASI_Rn02_00308787 predicted 704
4 SASI_Rn02_00308788 predicted 691
5 SASI_Rn02_00308789 predicted 638
6 SASI_Rn02_00308790 predicted 275
7 SASI_Rn02_00308791 predicted 281
8 SASI_Rn02_00308792 predicted 309
9 SASI_Rn02_00308793 predicted 348
10 SASI_Rn02_00308794 predicted 382
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573274 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00400114 predicted 328
2 SASI_Rn02_00400115 predicted 314
3 SASI_Rn02_00400116 predicted 707
4 SASI_Rn02_00400117 predicted 688
5 SASI_Rn02_00400118 predicted 629
6 SASI_Rn02_00400119 predicted 276
7 SASI_Rn02_00400120 predicted 284
8 SASI_Rn02_00400121 predicted 303
9 SASI_Rn02_00400122 predicted 353
10 SASI_Rn02_00400123 predicted 383
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027046 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00058695 predicted 300
2 SASI_Mm01_00058696 predicted 978
3 SASI_Mm01_00058697 predicted 320
4 SASI_Mm01_00058698 predicted 695
5 SASI_Mm01_00058699 predicted 636
6 SASI_Mm01_00058701 predicted 688
7 SASI_Mm01_00058702 predicted 753
8 SASI_Mm01_00058703 predicted 363
9 SASI_Mm01_00058704 predicted 897
10 SASI_Mm02_00331462 predicted 1046
11 SASI_Mm01_00058700 predicted 1062
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032600
CCDC54 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 54
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168332    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032600.2-295s1c1
Sequence:CCGGGTGGACTTCAAATCTCTCCAACTCGAGTTGGAGAGATTTGAAGTCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167183    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032600.2-362s1c1
Sequence:CCGGCACCAAGATTCAACTGGATATCTCGAGATATCCAGTTGAATCTTGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167275    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032600.2-612s1c1
Sequence:CCGGCGACTAAAGATATCCTCTCTACTCGAGTAGAGAGGATATCTTTAGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168218    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032600.2-1034s1c1
Sequence:CCGGCTCAGTGCTACCAAGTTAGAACTCGAGTTCTAACTTGGTAGCACTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032600.2-389s21c1
Sequence:CCGGGTGACATCTGATGATTGTAATCTCGAGATTACAATCATCAGATGTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032600.2-563s21c1
Sequence:CCGGGAGGTCCTGGAAACCAGAATGCTCGAGCATTCTGGTTTCCAGGACCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032600.2-448s21c1
Sequence:CCGGAGTAGTGCTCCAAGATGTTAACTCGAGTTAACATCTTGGAGCACTACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032600.2-489s21c1
Sequence:CCGGTCAGCCAAATGACTGACATTGCTCGAGCAATGTCAGTCATTTGGCTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032600.2-831s21c1
Sequence:CCGGCAGAGAAAGTGCCCAGTTATCCTCGAGGATAACTGGGCACTTTCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032600.2-688s21c1
Sequence:CCGGTTCCTGCTCCACGATACATTGCTCGAGCAATGTATCGTGGAGCAGGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032600
CCDC54 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 54
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168332    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032600.2-295s1c1
Sequence:CCGGGTGGACTTCAAATCTCTCCAACTCGAGTTGGAGAGATTTGAAGTCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167183    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032600.2-362s1c1
Sequence:CCGGCACCAAGATTCAACTGGATATCTCGAGATATCCAGTTGAATCTTGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167275    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032600.2-612s1c1
Sequence:CCGGCGACTAAAGATATCCTCTCTACTCGAGTAGAGAGGATATCTTTAGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168218    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032600.2-1034s1c1
Sequence:CCGGCTCAGTGCTACCAAGTTAGAACTCGAGTTCTAACTTGGTAGCACTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032600.2-389s21c1
Sequence:CCGGGTGACATCTGATGATTGTAATCTCGAGATTACAATCATCAGATGTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032600.2-563s21c1
Sequence:CCGGGAGGTCCTGGAAACCAGAATGCTCGAGCATTCTGGTTTCCAGGACCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032600.2-448s21c1
Sequence:CCGGAGTAGTGCTCCAAGATGTTAACTCGAGTTAACATCTTGGAGCACTACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032600.2-489s21c1
Sequence:CCGGTCAGCCAAATGACTGACATTGCTCGAGCAATGTCAGTCATTTGGCTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032600.2-831s21c1
Sequence:CCGGCAGAGAAAGTGCCCAGTTATCCTCGAGGATAACTGGGCACTTTCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032600.2-688s21c1
Sequence:CCGGTTCCTGCTCCACGATACATTGCTCGAGCAATGTATCGTGGAGCAGGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032600
CCDC54 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 54
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168332    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032600.2-295s1c1
Sequence:CCGGGTGGACTTCAAATCTCTCCAACTCGAGTTGGAGAGATTTGAAGTCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167183    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032600.2-362s1c1
Sequence:CCGGCACCAAGATTCAACTGGATATCTCGAGATATCCAGTTGAATCTTGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167275    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032600.2-612s1c1
Sequence:CCGGCGACTAAAGATATCCTCTCTACTCGAGTAGAGAGGATATCTTTAGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168218    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032600.2-1034s1c1
Sequence:CCGGCTCAGTGCTACCAAGTTAGAACTCGAGTTCTAACTTGGTAGCACTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032600.2-389s21c1
Sequence:CCGGGTGACATCTGATGATTGTAATCTCGAGATTACAATCATCAGATGTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032600.2-563s21c1
Sequence:CCGGGAGGTCCTGGAAACCAGAATGCTCGAGCATTCTGGTTTCCAGGACCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032600.2-448s21c1
Sequence:CCGGAGTAGTGCTCCAAGATGTTAACTCGAGTTAACATCTTGGAGCACTACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032600.2-489s21c1
Sequence:CCGGTCAGCCAAATGACTGACATTGCTCGAGCAATGTCAGTCATTTGGCTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032600.2-831s21c1
Sequence:CCGGCAGAGAAAGTGCCCAGTTATCCTCGAGGATAACTGGGCACTTTCTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032600.2-688s21c1
Sequence:CCGGTTCCTGCTCCACGATACATTGCTCGAGCAATGTATCGTGGAGCAGGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027046
CCDC54 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 54
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201082    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027046.2-622s1c1
Sequence:CCGGCAAAGACATGCTCTCCATGAACTCGAGTTCATGGAGAGCATGTCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027046.2-363s1c1
Sequence:CCGGCCCACCACTCATATTCAACTACTCGAGTAGTTGAATATGAGTGGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027046.2-412s1c1
Sequence:CCGGCGACGGAGATACTCTCAGTTTCTCGAGAAACTGAGAGTATCTCCGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027046.2-581s1c1
Sequence:CCGGGCCAGAATAAACATTAGTGAACTCGAGTTCACTAATGTTTATTCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027046.2-493s1c1
Sequence:CCGGCCTCAACCAAATGACGAACATCTCGAGATGTTCGTCATTTGGTTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217697    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027046.3-986s1c1
Sequence:CCGGGACTTCAGTACATGGATCAAGCTCGAGCTTGATCCATGTACTGAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216478    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027046.3-455s1c1
Sequence:CCGGGCAATGCTCCAAGACATTAAACTCGAGTTTAATGTCTTGGAGCATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215954    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027046.3-319s1c1
Sequence:CCGGCAAGATCAGAAGATCTCTTAACTCGAGTTAAGAGATCTTCTGATCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216429    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027046.3-644s1c1
Sequence:CCGGGAAGATATCAACACTCTAAAGCTCGAGCTTTAGAGTGTTGATATCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027046
CCDC54 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 54
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201082    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027046.2-622s1c1
Sequence:CCGGCAAAGACATGCTCTCCATGAACTCGAGTTCATGGAGAGCATGTCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027046.2-363s1c1
Sequence:CCGGCCCACCACTCATATTCAACTACTCGAGTAGTTGAATATGAGTGGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027046.2-412s1c1
Sequence:CCGGCGACGGAGATACTCTCAGTTTCTCGAGAAACTGAGAGTATCTCCGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027046.2-581s1c1
Sequence:CCGGGCCAGAATAAACATTAGTGAACTCGAGTTCACTAATGTTTATTCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027046.2-493s1c1
Sequence:CCGGCCTCAACCAAATGACGAACATCTCGAGATGTTCGTCATTTGGTTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217697    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027046.3-986s1c1
Sequence:CCGGGACTTCAGTACATGGATCAAGCTCGAGCTTGATCCATGTACTGAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216478    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027046.3-455s1c1
Sequence:CCGGGCAATGCTCCAAGACATTAAACTCGAGTTTAATGTCTTGGAGCATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215954    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027046.3-319s1c1
Sequence:CCGGCAAGATCAGAAGATCTCTTAACTCGAGTTAAGAGATCTTCTGATCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216429    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027046.3-644s1c1
Sequence:CCGGGAAGATATCAACACTCTAAAGCTCGAGCTTTAGAGTGTTGATATCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027046
CCDC54 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 54
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201082    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027046.2-622s1c1
Sequence:CCGGCAAAGACATGCTCTCCATGAACTCGAGTTCATGGAGAGCATGTCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027046.2-363s1c1
Sequence:CCGGCCCACCACTCATATTCAACTACTCGAGTAGTTGAATATGAGTGGTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027046.2-412s1c1
Sequence:CCGGCGACGGAGATACTCTCAGTTTCTCGAGAAACTGAGAGTATCTCCGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027046.2-581s1c1
Sequence:CCGGGCCAGAATAAACATTAGTGAACTCGAGTTCACTAATGTTTATTCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027046.2-493s1c1
Sequence:CCGGCCTCAACCAAATGACGAACATCTCGAGATGTTCGTCATTTGGTTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217697    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027046.3-986s1c1
Sequence:CCGGGACTTCAGTACATGGATCAAGCTCGAGCTTGATCCATGTACTGAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216478    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027046.3-455s1c1
Sequence:CCGGGCAATGCTCCAAGACATTAAACTCGAGTTTAATGTCTTGGAGCATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215954    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027046.3-319s1c1
Sequence:CCGGCAAGATCAGAAGATCTCTTAACTCGAGTTAAGAGATCTTCTGATCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216429    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027046.3-644s1c1
Sequence:CCGGGAAGATATCAACACTCTAAAGCTCGAGCTTTAGAGTGTTGATATCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)