EMAIL THIS PAGE TO A FRIEND

CCDC57

coiled-coil domain containing 57

34 Gene Product Result for
UniProtKB ID: Q2TAC2, A6NP51, A8MQC7, Q8IWG2, Q8TER3
Gene ID:
Mouse(71276) coiled-coil domain containing 57
Zebrafish(100318317) coiled-coil domain containing 57
cow(518878) coiled-coil domain containing 57
Horse(100057271) coiled-coil domain containing 57
domestic cat(101081772) coiled-coil domain containing 57
dog(607741) coiled-coil domain containing 57
chicken(417379) coiled-coil domain containing 57
naked mole-rat(101700240) coiled-coil domain containing 57
domestic guinea pig(100715773) coiled-coil domain containing 57
sheep(101106275) coiled-coil domain containing 57
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198082 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198082 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198082 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027745 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027745 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027745 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU013011 MISSION® esiRNA esiRNA targeting human CCDC57 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198082 Rosetta Predictions human pricing
NM_027745 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198082 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00126774 predicted 1782
2 SASI_Hs01_00126775 predicted 812
3 SASI_Hs01_00126776 predicted 1577
4 SASI_Hs01_00126777 predicted 1529
5 SASI_Hs01_00126778 predicted 1237
6 SASI_Hs01_00126779 predicted 867
7 SASI_Hs01_00126780 predicted 2759
8 SASI_Hs01_00126781 predicted 1835
9 SASI_Hs01_00126782 predicted 648
10 SASI_Hs01_00126783 predicted 1369
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027745 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00193380 predicted 857
2 SASI_Mm01_00193382 predicted 2614
3 SASI_Mm01_00193383 predicted 1350
4 SASI_Mm01_00193384 predicted 2489
5 SASI_Mm01_00193385 predicted 764
6 SASI_Mm01_00193386 predicted 1943
7 SASI_Mm01_00193387 predicted 2813
8 SASI_Mm01_00193388 predicted 2387
9 SASI_Mm01_00193389 predicted 937
10 SASI_Mm02_00332700 predicted 996
11 SASI_Mm01_00193381 predicted 3137
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198082
CCDC57 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 57
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000167936    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198082.1-962s1c1
Sequence:CCGGCGGGAGCTTAAGGTTAAACTACTCGAGTAGTTTAACCTTAAGCTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167776    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198082.1-1190s1c1
Sequence:CCGGGAAACATTTAAGAGGAAGCATCTCGAGATGCTTCCTCTTAAATGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167622    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198082.1-1445s1c1
Sequence:CCGGGATGCTCAAATTGCTCAACTACTCGAGTAGTTGAGCAATTTGAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166945    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198082.1-2156s1c1
Sequence:CCGGGAAGATGTGTTGGATCCTTTACTCGAGTAAAGGATCCAACACATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168788    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198082.1-1552s1c1
Sequence:CCGGGCAGGACATTGAAAGGTACAACTCGAGTTGTACCTTTCAATGTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173053    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198082.1-1549s1c1
Sequence:CCGGCCAGCAGGACATTGAAAGGTACTCGAGTACCTTTCAATGTCCTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198082
CCDC57 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 57
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000167936    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198082.1-962s1c1
Sequence:CCGGCGGGAGCTTAAGGTTAAACTACTCGAGTAGTTTAACCTTAAGCTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167776    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198082.1-1190s1c1
Sequence:CCGGGAAACATTTAAGAGGAAGCATCTCGAGATGCTTCCTCTTAAATGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167622    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198082.1-1445s1c1
Sequence:CCGGGATGCTCAAATTGCTCAACTACTCGAGTAGTTGAGCAATTTGAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166945    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198082.1-2156s1c1
Sequence:CCGGGAAGATGTGTTGGATCCTTTACTCGAGTAAAGGATCCAACACATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168788    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198082.1-1552s1c1
Sequence:CCGGGCAGGACATTGAAAGGTACAACTCGAGTTGTACCTTTCAATGTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173053    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198082.1-1549s1c1
Sequence:CCGGCCAGCAGGACATTGAAAGGTACTCGAGTACCTTTCAATGTCCTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198082
CCDC57 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 57
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000167936    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198082.1-962s1c1
Sequence:CCGGCGGGAGCTTAAGGTTAAACTACTCGAGTAGTTTAACCTTAAGCTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167776    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198082.1-1190s1c1
Sequence:CCGGGAAACATTTAAGAGGAAGCATCTCGAGATGCTTCCTCTTAAATGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167622    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198082.1-1445s1c1
Sequence:CCGGGATGCTCAAATTGCTCAACTACTCGAGTAGTTGAGCAATTTGAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166945    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198082.1-2156s1c1
Sequence:CCGGGAAGATGTGTTGGATCCTTTACTCGAGTAAAGGATCCAACACATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168788    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198082.1-1552s1c1
Sequence:CCGGGCAGGACATTGAAAGGTACAACTCGAGTTGTACCTTTCAATGTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173053    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198082.1-1549s1c1
Sequence:CCGGCCAGCAGGACATTGAAAGGTACTCGAGTACCTTTCAATGTCCTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027745
CCDC57 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 57
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000184068    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027745.1-3077s1c1
Sequence:CCGGCCTTTGCTGTCAAAGGGCTAACTCGAGTTAGCCCTTTGACAGCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179103    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027745.1-1885s1c1
Sequence:CCGGCCAGATTATGTTCTGACCCTTCTCGAGAAGGGTCAGAACATAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184135    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027745.1-1359s1c1
Sequence:CCGGCCAACAGGACATAGACAGGTACTCGAGTACCTGTCTATGTCCTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267457    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027745.1-3267s21c1
Sequence:CCGGGCCTGTGGTTATACAAGTTGGCTCGAGCCAACTTGTATAACCACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027745.1-927s21c1
Sequence:CCGGCGTGAAGGACGCTCGGATAAACTCGAGTTTATCCGAGCGTCCTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027745.1-1456s21c1
Sequence:CCGGCAGCGTCGCTGCGATGATATTCTCGAGAATATCATCGCAGCGACGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027745.1-859s21c1
Sequence:CCGGGAAGCAGAACACGTGGAATTACTCGAGTAATTCCACGTGTTCTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217385    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027745.1-859s1c1
Sequence:CCGGGAAGCAGAACACGTGGAATTACTCGAGTAATTCCACGTGTTCTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027745.1-2386s21c1
Sequence:CCGGCAGCCTCCACAGACCATATATCTCGAGATATATGGTCTGTGGAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027745
CCDC57 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 57
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000184068    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027745.1-3077s1c1
Sequence:CCGGCCTTTGCTGTCAAAGGGCTAACTCGAGTTAGCCCTTTGACAGCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179103    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027745.1-1885s1c1
Sequence:CCGGCCAGATTATGTTCTGACCCTTCTCGAGAAGGGTCAGAACATAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184135    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027745.1-1359s1c1
Sequence:CCGGCCAACAGGACATAGACAGGTACTCGAGTACCTGTCTATGTCCTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267457    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027745.1-3267s21c1
Sequence:CCGGGCCTGTGGTTATACAAGTTGGCTCGAGCCAACTTGTATAACCACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027745.1-927s21c1
Sequence:CCGGCGTGAAGGACGCTCGGATAAACTCGAGTTTATCCGAGCGTCCTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027745.1-1456s21c1
Sequence:CCGGCAGCGTCGCTGCGATGATATTCTCGAGAATATCATCGCAGCGACGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027745.1-859s21c1
Sequence:CCGGGAAGCAGAACACGTGGAATTACTCGAGTAATTCCACGTGTTCTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217385    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027745.1-859s1c1
Sequence:CCGGGAAGCAGAACACGTGGAATTACTCGAGTAATTCCACGTGTTCTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027745.1-2386s21c1
Sequence:CCGGCAGCCTCCACAGACCATATATCTCGAGATATATGGTCTGTGGAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027745
CCDC57 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 57
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000184068    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027745.1-3077s1c1
Sequence:CCGGCCTTTGCTGTCAAAGGGCTAACTCGAGTTAGCCCTTTGACAGCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179103    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027745.1-1885s1c1
Sequence:CCGGCCAGATTATGTTCTGACCCTTCTCGAGAAGGGTCAGAACATAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184135    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027745.1-1359s1c1
Sequence:CCGGCCAACAGGACATAGACAGGTACTCGAGTACCTGTCTATGTCCTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267457    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027745.1-3267s21c1
Sequence:CCGGGCCTGTGGTTATACAAGTTGGCTCGAGCCAACTTGTATAACCACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027745.1-927s21c1
Sequence:CCGGCGTGAAGGACGCTCGGATAAACTCGAGTTTATCCGAGCGTCCTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027745.1-1456s21c1
Sequence:CCGGCAGCGTCGCTGCGATGATATTCTCGAGAATATCATCGCAGCGACGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027745.1-859s21c1
Sequence:CCGGGAAGCAGAACACGTGGAATTACTCGAGTAATTCCACGTGTTCTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217385    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027745.1-859s1c1
Sequence:CCGGGAAGCAGAACACGTGGAATTACTCGAGTAATTCCACGTGTTCTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027745.1-2386s21c1
Sequence:CCGGCAGCCTCCACAGACCATATATCTCGAGATATATGGTCTGTGGAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks