EMAIL THIS PAGE TO A FRIEND

CCDC59

coiled-coil domain containing 59

Synonyms: BR22 TAP26
UniProtKB ID: Q9P031, Q9H2V5, Q9NW62
Gene ID:
Mouse(52713) coiled-coil domain containing 59
Rat(314799) coiled-coil domain containing 59
Zebrafish(564488) coiled-coil domain containing 59
chicken(417878) coiled-coil domain containing 59
domestic cat(101093619) coiled-coil domain containing 59
cow(615189) coiled-coil domain containing 59
dog(611585) coiled-coil domain containing 59
domestic guinea pig(100733626) coiled-coil domain containing 59
sheep(101106509) coiled-coil domain containing 59
51 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014167 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014167 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014167 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025602 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025602 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025602 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU111861 MISSION® esiRNA esiRNA human CCDC59 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014167 Rosetta Predictions human pricing
NM_001108090 Rosetta Predictions rat pricing
NM_025602 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014167 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00172315 predicted 793
2 SASI_Hs01_00172316 predicted 270
3 SASI_Hs01_00172319 predicted 269
4 SASI_Hs01_00172321 predicted 297
5 SASI_Hs02_00345162 predicted 797
6 SASI_Hs02_00345163 predicted 296
7 SASI_Hs01_00172313 predicted 797
8 SASI_Hs02_00345164 predicted 292
9 SASI_Hs02_00345165 predicted 119
10 SASI_Hs02_00345166 predicted 631
11 SASI_Hs01_00172312 predicted 252
12 SASI_Hs01_00172314 predicted 799
13 SASI_Hs01_00172317 predicted 783
14 SASI_Hs01_00172318 predicted 256
15 SASI_Hs01_00172320 predicted 806
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108090 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235254 predicted 809
2 SASI_Rn02_00235255 predicted 623
3 SASI_Rn02_00235256 predicted 692
4 SASI_Rn02_00235257 predicted 807
5 SASI_Rn02_00235258 predicted 673
6 SASI_Rn02_00235259 predicted 742
7 SASI_Rn02_00235260 predicted 490
8 SASI_Rn02_00235261 predicted 747
9 SASI_Rn02_00235262 predicted 668
10 SASI_Rn02_00235263 predicted 714
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025602 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00328622 predicted 345
2 SASI_Mm02_00328623 predicted 344
3 SASI_Mm02_00328624 predicted 345
4 SASI_Mm01_00164273 predicted 375
5 SASI_Mm01_00164274 predicted 402
6 SASI_Mm01_00164276 predicted 246
7 SASI_Mm01_00164277 predicted 400
8 SASI_Mm01_00164278 predicted 270
9 SASI_Mm01_00164279 predicted 373
10 SASI_Mm01_00164280 predicted 247
11 SASI_Mm01_00164271 predicted 355
12 SASI_Mm01_00164272 predicted 291
13 SASI_Mm01_00164275 predicted 358
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014167
VALIDATED
CCDC59 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 59
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143153    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014167.1-383s1c1
Sequence:CCGGCGTTGCTTGAAGAACAGTGTACTCGAGTACACTGTTCTTCAAGCAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_014167.1-565s1c1
Sequence:CCGGCGTGCTGCTAAGAAACAAGAACTCGAGTTCTTGTTTCTTAGCAGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_014167.1-388s1c1
Sequence:CCGGCTTGAAGAACAGTGTAGCATTCTCGAGAATGCTACACTGTTCTTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121977    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_014167.1-814s1c1
Sequence:CCGGGTGAACTAAATTTGTCGACATCTCGAGATGTCGACAAATTTAGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145219    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014167.1-696s1c1
Sequence:CCGGGAATGTACAAATGGAGTACCTCTCGAGAGGTACTCCATTTGTACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144173    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_014167.1-829s1c1
Sequence:CCGGCGACATAAACTGGATTGCTAACTCGAGTTAGCAATCCAGTTTATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_014167.1-703s1c1
Sequence:CCGGCAAATGGAGTACCTTCTTCAACTCGAGTTGAAGAAGGTACTCCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014167
VALIDATED
CCDC59 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 59
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143153    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014167.1-383s1c1
Sequence:CCGGCGTTGCTTGAAGAACAGTGTACTCGAGTACACTGTTCTTCAAGCAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_014167.1-565s1c1
Sequence:CCGGCGTGCTGCTAAGAAACAAGAACTCGAGTTCTTGTTTCTTAGCAGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_014167.1-388s1c1
Sequence:CCGGCTTGAAGAACAGTGTAGCATTCTCGAGAATGCTACACTGTTCTTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121977    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_014167.1-814s1c1
Sequence:CCGGGTGAACTAAATTTGTCGACATCTCGAGATGTCGACAAATTTAGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145219    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014167.1-696s1c1
Sequence:CCGGGAATGTACAAATGGAGTACCTCTCGAGAGGTACTCCATTTGTACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144173    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_014167.1-829s1c1
Sequence:CCGGCGACATAAACTGGATTGCTAACTCGAGTTAGCAATCCAGTTTATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_014167.1-703s1c1
Sequence:CCGGCAAATGGAGTACCTTCTTCAACTCGAGTTGAAGAAGGTACTCCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014167
VALIDATED
CCDC59 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 59
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143153    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014167.1-383s1c1
Sequence:CCGGCGTTGCTTGAAGAACAGTGTACTCGAGTACACTGTTCTTCAAGCAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_014167.1-565s1c1
Sequence:CCGGCGTGCTGCTAAGAAACAAGAACTCGAGTTCTTGTTTCTTAGCAGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_014167.1-388s1c1
Sequence:CCGGCTTGAAGAACAGTGTAGCATTCTCGAGAATGCTACACTGTTCTTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121977    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_014167.1-814s1c1
Sequence:CCGGGTGAACTAAATTTGTCGACATCTCGAGATGTCGACAAATTTAGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145219    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014167.1-696s1c1
Sequence:CCGGGAATGTACAAATGGAGTACCTCTCGAGAGGTACTCCATTTGTACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144173    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_014167.1-829s1c1
Sequence:CCGGCGACATAAACTGGATTGCTAACTCGAGTTAGCAATCCAGTTTATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_014167.1-703s1c1
Sequence:CCGGCAAATGGAGTACCTTCTTCAACTCGAGTTGAAGAAGGTACTCCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025602
VALIDATED
CCDC59 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 59
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202078    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025602.1-320s1c1
Sequence:CCGGCCGAAGAGGAAAGACTCAGAACTCGAGTTCTGAGTCTTTCCTCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200805    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025602.1-690s1c1
Sequence:CCGGGCCTAACCTGAATTTACAGATCTCGAGATCTGTAAATTCAGGTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190228    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025602.1-90s1c1
Sequence:CCGGCTCTCAGGTCAGATTCGGAAACTCGAGTTTCCGAATCTGACCTGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025602.3-562s21c1
Sequence:CCGGCGAAGCGTGCTGCTAAGAAATCTCGAGATTTCTTAGCAGCACGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025602.3-684s21c1
Sequence:CCGGGGCCAGCCTAACCTGAATTTACTCGAGTAAATTCAGGTTAGGCTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025602.3-84s21c1
Sequence:CCGGGGGATCTCTCAGGTCAGATTCCTCGAGGAATCTGACCTGAGAGATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249588    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025602.3-806s21c1
Sequence:CCGGGTATGGGAACCTCCTAATAATCTCGAGATTATTAGGAGGTTCCCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025602.3-739s21c1
Sequence:CCGGACAGTTAAAGCGGACACTTTGCTCGAGCAAAGTGTCCGCTTTAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025602
VALIDATED
CCDC59 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 59
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202078    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025602.1-320s1c1
Sequence:CCGGCCGAAGAGGAAAGACTCAGAACTCGAGTTCTGAGTCTTTCCTCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200805    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025602.1-690s1c1
Sequence:CCGGGCCTAACCTGAATTTACAGATCTCGAGATCTGTAAATTCAGGTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190228    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025602.1-90s1c1
Sequence:CCGGCTCTCAGGTCAGATTCGGAAACTCGAGTTTCCGAATCTGACCTGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025602.3-562s21c1
Sequence:CCGGCGAAGCGTGCTGCTAAGAAATCTCGAGATTTCTTAGCAGCACGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025602.3-684s21c1
Sequence:CCGGGGCCAGCCTAACCTGAATTTACTCGAGTAAATTCAGGTTAGGCTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025602.3-84s21c1
Sequence:CCGGGGGATCTCTCAGGTCAGATTCCTCGAGGAATCTGACCTGAGAGATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249588    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025602.3-806s21c1
Sequence:CCGGGTATGGGAACCTCCTAATAATCTCGAGATTATTAGGAGGTTCCCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025602.3-739s21c1
Sequence:CCGGACAGTTAAAGCGGACACTTTGCTCGAGCAAAGTGTCCGCTTTAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025602
VALIDATED
CCDC59 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 59
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202078    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025602.1-320s1c1
Sequence:CCGGCCGAAGAGGAAAGACTCAGAACTCGAGTTCTGAGTCTTTCCTCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200805    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025602.1-690s1c1
Sequence:CCGGGCCTAACCTGAATTTACAGATCTCGAGATCTGTAAATTCAGGTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190228    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025602.1-90s1c1
Sequence:CCGGCTCTCAGGTCAGATTCGGAAACTCGAGTTTCCGAATCTGACCTGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025602.3-562s21c1
Sequence:CCGGCGAAGCGTGCTGCTAAGAAATCTCGAGATTTCTTAGCAGCACGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025602.3-684s21c1
Sequence:CCGGGGCCAGCCTAACCTGAATTTACTCGAGTAAATTCAGGTTAGGCTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025602.3-84s21c1
Sequence:CCGGGGGATCTCTCAGGTCAGATTCCTCGAGGAATCTGACCTGAGAGATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249588    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025602.3-806s21c1
Sequence:CCGGGTATGGGAACCTCCTAATAATCTCGAGATTATTAGGAGGTTCCCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025602.3-739s21c1
Sequence:CCGGACAGTTAAAGCGGACACTTTGCTCGAGCAAAGTGTCCGCTTTAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks