EMAIL THIS PAGE TO A FRIEND

CCDC60

coiled-coil domain containing 60

44 Gene Product Result for
UniProtKB ID: Q8IWA6
Gene ID:
Mouse(269693) coiled-coil domain containing 60
Rat(498190) coiled-coil domain containing 60
chicken(416987) coiled-coil domain containing 60
domestic cat(101101089) coiled-coil domain containing 60
cow(614062) coiled-coil domain containing 60
dog(477504) coiled-coil domain containing 60
naked mole-rat(101719691) coiled-coil domain containing 60
domestic guinea pig(100731058) coiled-coil domain containing 60
sheep(101106285) coiled-coil domain containing 60
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV53371 Anti-CCDC60 antibody produced in rabbit affinity isolated antibody mouse, rat, horse, guinea pig, canine, human, rabbit
western blot pricing
HPA039048 Anti-CCDC60 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177759 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177759 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177759 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_178499 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178499 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178499 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU131061 MISSION® esiRNA esiRNA human CCDC60 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178499 Rosetta Predictions human pricing
NM_001034945 Rosetta Predictions rat pricing
NM_177759 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178499 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00369741 predicted 1102
2 SASI_Hs01_00099802 predicted 1566
3 SASI_Hs01_00099804 predicted 1451
4 SASI_Hs01_00099805 predicted 801
5 SASI_Hs01_00099807 predicted 611
6 SASI_Hs01_00099808 predicted 2002
7 SASI_Hs01_00099809 predicted 1603
8 SASI_Hs01_00099810 predicted 1573
9 SASI_Hs01_00099811 predicted 1285
10 SASI_Hs02_00369742 predicted 2016
11 SASI_Hs01_00099803 predicted 571
12 SASI_Hs01_00099806 predicted 1324
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034945 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00056238 predicted 1534
2 SASI_Rn01_00056239 predicted 1926
3 SASI_Rn01_00056240 predicted 615
4 SASI_Rn01_00056241 predicted 1652
5 SASI_Rn01_00056242 predicted 1388
6 SASI_Rn02_00204132 predicted 512
7 SASI_Rn01_00056243 predicted 1309
8 SASI_Rn01_00056245 predicted 1497
9 SASI_Rn01_00056246 predicted 787
10 SASI_Rn02_00204133 predicted 899
11 SASI_Rn01_00056244 predicted 1259
12 SASI_Rn01_00056247 predicted 993
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177759 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00076801 predicted 1690
2 SASI_Mm01_00076802 predicted 1537
3 SASI_Mm01_00076803 predicted 1269
4 SASI_Mm01_00076804 predicted 1990
5 SASI_Mm01_00076805 predicted 760
6 SASI_Mm01_00076806 predicted 1432
7 SASI_Mm01_00076807 predicted 1581
8 SASI_Mm01_00076808 predicted 1400
9 SASI_Mm01_00076809 predicted 826
10 SASI_Mm01_00076810 predicted 1023
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177759
CCDC60 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 60
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000198243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177759.2-592s1c1
Sequence:CCGGGCAAACCTTAAGAAGGATCTTCTCGAGAAGATCCTTCTTAAGGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197449    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177759.2-2355s1c1
Sequence:CCGGCCTGGATAATAAATCTAACCTCTCGAGAGGTTAGATTTATTATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177759.2-569s1c1
Sequence:CCGGCCAAATATATAGACAAGGAGACTCGAGTCTCCTTGTCTATATATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177759.2-798s1c1
Sequence:CCGGCTACGACTGTGAGAAGCTAAACTCGAGTTTAGCTTCTCACAGTCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178056    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177759.2-2202s1c1
Sequence:CCGGGCTGAAGACACTTCTAACAATCTCGAGATTGTTAGAAGTGTCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177759
CCDC60 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 60
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000198243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177759.2-592s1c1
Sequence:CCGGGCAAACCTTAAGAAGGATCTTCTCGAGAAGATCCTTCTTAAGGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197449    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177759.2-2355s1c1
Sequence:CCGGCCTGGATAATAAATCTAACCTCTCGAGAGGTTAGATTTATTATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177759.2-569s1c1
Sequence:CCGGCCAAATATATAGACAAGGAGACTCGAGTCTCCTTGTCTATATATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177759.2-798s1c1
Sequence:CCGGCTACGACTGTGAGAAGCTAAACTCGAGTTTAGCTTCTCACAGTCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178056    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177759.2-2202s1c1
Sequence:CCGGGCTGAAGACACTTCTAACAATCTCGAGATTGTTAGAAGTGTCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177759
CCDC60 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 60
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000198243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177759.2-592s1c1
Sequence:CCGGGCAAACCTTAAGAAGGATCTTCTCGAGAAGATCCTTCTTAAGGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197449    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177759.2-2355s1c1
Sequence:CCGGCCTGGATAATAAATCTAACCTCTCGAGAGGTTAGATTTATTATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177759.2-569s1c1
Sequence:CCGGCCAAATATATAGACAAGGAGACTCGAGTCTCCTTGTCTATATATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177759.2-798s1c1
Sequence:CCGGCTACGACTGTGAGAAGCTAAACTCGAGTTTAGCTTCTCACAGTCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178056    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177759.2-2202s1c1
Sequence:CCGGGCTGAAGACACTTCTAACAATCTCGAGATTGTTAGAAGTGTCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178499
CCDC60 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 60
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000144922    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178499.2-2161s1c1
Sequence:CCGGGCCTATATCATGTTCCTGTATCTCGAGATACAGGAACATGATATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178499.2-1821s1c1
Sequence:CCGGCCACTGGTACTTTGATCTGTTCTCGAGAACAGATCAAAGTACCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142250    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178499.2-2257s1c1
Sequence:CCGGGAGACTGACTTCCAGCAACATCTCGAGATGTTGCTGGAAGTCAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178499.2-1092s1c1
Sequence:CCGGGCATTTCATCACAGCGCCAAACTCGAGTTTGGCGCTGTGATGAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178499.2-652s1c1
Sequence:CCGGGTGAAGATAGGCCGTGGATATCTCGAGATATCCACGGCCTATCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178499.3-1067s21c1
Sequence:CCGGACAAGTCCATGGGACAGAAATCTCGAGATTTCTGTCCCATGGACTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178499.3-1458s21c1
Sequence:CCGGCAAGAGTAATTCTGCTTATAACTCGAGTTATAAGCAGAATTACTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178499
CCDC60 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 60
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000144922    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178499.2-2161s1c1
Sequence:CCGGGCCTATATCATGTTCCTGTATCTCGAGATACAGGAACATGATATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178499.2-1821s1c1
Sequence:CCGGCCACTGGTACTTTGATCTGTTCTCGAGAACAGATCAAAGTACCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142250    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178499.2-2257s1c1
Sequence:CCGGGAGACTGACTTCCAGCAACATCTCGAGATGTTGCTGGAAGTCAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178499.2-1092s1c1
Sequence:CCGGGCATTTCATCACAGCGCCAAACTCGAGTTTGGCGCTGTGATGAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178499.2-652s1c1
Sequence:CCGGGTGAAGATAGGCCGTGGATATCTCGAGATATCCACGGCCTATCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178499.3-1067s21c1
Sequence:CCGGACAAGTCCATGGGACAGAAATCTCGAGATTTCTGTCCCATGGACTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178499.3-1458s21c1
Sequence:CCGGCAAGAGTAATTCTGCTTATAACTCGAGTTATAAGCAGAATTACTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178499
CCDC60 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 60
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000144922    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178499.2-2161s1c1
Sequence:CCGGGCCTATATCATGTTCCTGTATCTCGAGATACAGGAACATGATATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178499.2-1821s1c1
Sequence:CCGGCCACTGGTACTTTGATCTGTTCTCGAGAACAGATCAAAGTACCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142250    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178499.2-2257s1c1
Sequence:CCGGGAGACTGACTTCCAGCAACATCTCGAGATGTTGCTGGAAGTCAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178499.2-1092s1c1
Sequence:CCGGGCATTTCATCACAGCGCCAAACTCGAGTTTGGCGCTGTGATGAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178499.2-652s1c1
Sequence:CCGGGTGAAGATAGGCCGTGGATATCTCGAGATATCCACGGCCTATCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178499.3-1067s21c1
Sequence:CCGGACAAGTCCATGGGACAGAAATCTCGAGATTTCTGTCCCATGGACTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178499.3-1458s21c1
Sequence:CCGGCAAGAGTAATTCTGCTTATAACTCGAGTTATAAGCAGAATTACTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks