EMAIL THIS PAGE TO A FRIEND

CCDC62

coiled-coil domain containing 62

105 Gene Product Result for
Synonyms: CT109 ERAP75 TSP-NY
UniProtKB ID: Q6P9F0, A8K8V1, B3KUP3, Q6ZVF2, Q86VJ0, Q9BYZ5
Gene ID:
Mouse(208908) coiled-coil domain containing 62
Rat(689909) coiled-coil domain containing 62
domestic cat(101090969) coiled-coil domain containing 62
cow(515631) coiled-coil domain containing 62
Horse(100060472) coiled-coil domain containing 62
dog(477458) coiled-coil domain containing 62
naked mole-rat(101714469) coiled-coil domain containing 62
domestic guinea pig(100736079) coiled-coil domain containing 62
sheep(101123584) coiled-coil domain containing 62
Domestic Rabbit(100345549) coiled-coil domain containing 62
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032573 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032573 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032573 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001134767 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001134767 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001134767 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU145741 MISSION® esiRNA esiRNA human CCDC62 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032573 Rosetta Predictions human pricing
NM_201435 Rosetta Predictions human pricing
NM_001134766 Rosetta Predictions rat pricing
XM_915492 Rosetta Predictions mouse pricing
XM_978048 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032573 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00360091 predicted 984
2 SASI_Hs01_00062005 predicted 964
3 SASI_Hs01_00062006 predicted 674
4 SASI_Hs01_00062007 predicted 1328
5 SASI_Hs01_00062009 predicted 1310
6 SASI_Hs01_00062010 predicted 361
7 SASI_Hs01_00062011 predicted 1765
8 SASI_Hs01_00062012 predicted 1164
9 SASI_Hs01_00062013 predicted 847
10 SASI_Hs01_00062014 predicted 546
11 SASI_Hs01_00062008 predicted 1130
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201435 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372973 predicted 984
2 SASI_Hs01_00017594 predicted 965
3 SASI_Hs01_00017595 predicted 669
4 SASI_Hs01_00017596 predicted 1329
5 SASI_Hs01_00017598 predicted 1312
6 SASI_Hs01_00017599 predicted 362
7 SASI_Hs01_00017600 predicted 1770
8 SASI_Hs01_00017601 predicted 1164
9 SASI_Hs01_00017602 predicted 851
10 SASI_Hs01_00017603 predicted 544
11 SASI_Hs01_00017597 predicted 1128
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134766 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00258464 predicted 966
2 SASI_Rn02_00258465 predicted 1171
3 SASI_Rn02_00258466 predicted 905
4 SASI_Rn02_00258467 predicted 1665
5 SASI_Rn02_00258468 predicted 380
6 SASI_Rn02_00258469 predicted 828
7 SASI_Rn02_00258470 predicted 629
8 SASI_Rn02_00258471 predicted 281
9 SASI_Rn02_00258472 predicted 1396
10 SASI_Rn02_00258473 predicted 246
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_915492 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00439508 predicted 982
2 SASI_Mm02_00439509 predicted 753
3 SASI_Mm02_00439510 predicted 919
4 SASI_Mm02_00439511 predicted 1679
5 SASI_Mm02_00439512 predicted 2282
6 SASI_Mm02_00439513 predicted 637
7 SASI_Mm02_00439514 predicted 1268
8 SASI_Mm02_00439515 predicted 1793
9 SASI_Mm02_00439516 predicted 1642
10 SASI_Mm02_00439517 predicted 877
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_978048 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00446533 predicted 771
2 SASI_Mm01_00234887 predicted 981
3 SASI_Mm02_00446534 predicted 759
4 SASI_Mm02_00446535 predicted 918
5 SASI_Mm01_00234889 predicted 1671
6 SASI_Mm02_00446536 predicted 630
7 SASI_Mm01_00234891 predicted 1058
8 SASI_Mm01_00234892 predicted 1270
9 SASI_Mm01_00234894 predicted 1115
10 SASI_Mm02_00446537 predicted 1789
11 SASI_Mm01_00234885 predicted 1918
12 SASI_Mm01_00234886 predicted 1215
13 SASI_Mm01_00234888 predicted 1319
14 SASI_Mm01_00234890 predicted 1046
15 SASI_Mm01_00234893 predicted 962
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032573
CCDC62 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 62
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138903    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032573.3-1607s1c1
Sequence:CCGGGATCAGATGGAAAGGTCCGAACTCGAGTTCGGACCTTTCCATCTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032573.3-1775s1c1
Sequence:CCGGCAGAGAATTGTCCGCCTCAAACTCGAGTTTGAGGCGGACAATTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137679    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032573.3-1814s1c1
Sequence:CCGGGAAAGCATCTGTGGCACACAACTCGAGTTGTGTGCCACAGATGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032573.3-1624s1c1
Sequence:CCGGCGAAATCTCATGCTGCCAGAACTCGAGTTCTGGCAGCATGAGATTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032573.3-1195s1c1
Sequence:CCGGGTCACTGTTTAAGGACCAGAACTCGAGTTCTGGTCCTTAAACAGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134666    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032573.3-2227s1c1
Sequence:CCGGGTTCTTCATAAACGGCACTTACTCGAGTAAGTGCCGTTTATGAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032573.3-1277s1c1
Sequence:CCGGGAGAAGAAACAACAGATCGATCTCGAGATCGATCTGTTGTTTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032573.3-208s1c1
Sequence:CCGGCACTATCGAGAAACAACGGAACTCGAGTTCCGTTGTTTCTCGATAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032573.5-1322s21c1
Sequence:CCGGATTACGCTGTCATCCATATTCCTCGAGGAATATGGATGACAGCGTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032573.5-611s21c1
Sequence:CCGGGAACAAGCTCTTACGACAATGCTCGAGCATTGTCGTAAGAGCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416393    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032573.5-2415s21c1
Sequence:CCGGAGATACGGACTACAGTTAAATCTCGAGATTTAACTGTAGTCCGTATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032573
CCDC62 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 62
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138903    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032573.3-1607s1c1
Sequence:CCGGGATCAGATGGAAAGGTCCGAACTCGAGTTCGGACCTTTCCATCTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032573.3-1775s1c1
Sequence:CCGGCAGAGAATTGTCCGCCTCAAACTCGAGTTTGAGGCGGACAATTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137679    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032573.3-1814s1c1
Sequence:CCGGGAAAGCATCTGTGGCACACAACTCGAGTTGTGTGCCACAGATGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032573.3-1624s1c1
Sequence:CCGGCGAAATCTCATGCTGCCAGAACTCGAGTTCTGGCAGCATGAGATTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032573.3-1195s1c1
Sequence:CCGGGTCACTGTTTAAGGACCAGAACTCGAGTTCTGGTCCTTAAACAGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134666    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032573.3-2227s1c1
Sequence:CCGGGTTCTTCATAAACGGCACTTACTCGAGTAAGTGCCGTTTATGAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032573.3-1277s1c1
Sequence:CCGGGAGAAGAAACAACAGATCGATCTCGAGATCGATCTGTTGTTTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032573.3-208s1c1
Sequence:CCGGCACTATCGAGAAACAACGGAACTCGAGTTCCGTTGTTTCTCGATAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032573.5-1322s21c1
Sequence:CCGGATTACGCTGTCATCCATATTCCTCGAGGAATATGGATGACAGCGTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032573.5-611s21c1
Sequence:CCGGGAACAAGCTCTTACGACAATGCTCGAGCATTGTCGTAAGAGCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416393    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032573.5-2415s21c1
Sequence:CCGGAGATACGGACTACAGTTAAATCTCGAGATTTAACTGTAGTCCGTATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032573
CCDC62 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 62
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138903    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032573.3-1607s1c1
Sequence:CCGGGATCAGATGGAAAGGTCCGAACTCGAGTTCGGACCTTTCCATCTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032573.3-1775s1c1
Sequence:CCGGCAGAGAATTGTCCGCCTCAAACTCGAGTTTGAGGCGGACAATTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137679    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032573.3-1814s1c1
Sequence:CCGGGAAAGCATCTGTGGCACACAACTCGAGTTGTGTGCCACAGATGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032573.3-1624s1c1
Sequence:CCGGCGAAATCTCATGCTGCCAGAACTCGAGTTCTGGCAGCATGAGATTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032573.3-1195s1c1
Sequence:CCGGGTCACTGTTTAAGGACCAGAACTCGAGTTCTGGTCCTTAAACAGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134666    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032573.3-2227s1c1
Sequence:CCGGGTTCTTCATAAACGGCACTTACTCGAGTAAGTGCCGTTTATGAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032573.3-1277s1c1
Sequence:CCGGGAGAAGAAACAACAGATCGATCTCGAGATCGATCTGTTGTTTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032573.3-208s1c1
Sequence:CCGGCACTATCGAGAAACAACGGAACTCGAGTTCCGTTGTTTCTCGATAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032573.5-1322s21c1
Sequence:CCGGATTACGCTGTCATCCATATTCCTCGAGGAATATGGATGACAGCGTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032573.5-611s21c1
Sequence:CCGGGAACAAGCTCTTACGACAATGCTCGAGCATTGTCGTAAGAGCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416393    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032573.5-2415s21c1
Sequence:CCGGAGATACGGACTACAGTTAAATCTCGAGATTTAACTGTAGTCCGTATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001134767
CCDC62 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 62
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134767.1-2031s21c1
Sequence:CCGGTACCCATCAGCTGCGAGAATCCTCGAGGATTCTCGCAGCTGATGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134767.1-953s21c1
Sequence:CCGGTCAAAGCAAGATCGTACAAATCTCGAGATTTGTACGATCTTGCTTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134767.1-882s21c1
Sequence:CCGGGTCTACATGATGAGCTAATTTCTCGAGAAATTAGCTCATCATGTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134767.1-142s21c1
Sequence:CCGGGAACCCTTCGGCGACCTTATACTCGAGTATAAGGTCGCCGAAGGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252842    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001134767.1-3201s21c1
Sequence:CCGGACTGCCGATGAAGGTTGTATTCTCGAGAATACAACCTTCATCGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001134767
CCDC62 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 62
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134767.1-2031s21c1
Sequence:CCGGTACCCATCAGCTGCGAGAATCCTCGAGGATTCTCGCAGCTGATGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134767.1-953s21c1
Sequence:CCGGTCAAAGCAAGATCGTACAAATCTCGAGATTTGTACGATCTTGCTTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134767.1-882s21c1
Sequence:CCGGGTCTACATGATGAGCTAATTTCTCGAGAAATTAGCTCATCATGTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134767.1-142s21c1
Sequence:CCGGGAACCCTTCGGCGACCTTATACTCGAGTATAAGGTCGCCGAAGGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252842    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001134767.1-3201s21c1
Sequence:CCGGACTGCCGATGAAGGTTGTATTCTCGAGAATACAACCTTCATCGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001134767
CCDC62 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 62
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134767.1-2031s21c1
Sequence:CCGGTACCCATCAGCTGCGAGAATCCTCGAGGATTCTCGCAGCTGATGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134767.1-953s21c1
Sequence:CCGGTCAAAGCAAGATCGTACAAATCTCGAGATTTGTACGATCTTGCTTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134767.1-882s21c1
Sequence:CCGGGTCTACATGATGAGCTAATTTCTCGAGAAATTAGCTCATCATGTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134767.1-142s21c1
Sequence:CCGGGAACCCTTCGGCGACCTTATACTCGAGTATAAGGTCGCCGAAGGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252842    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001134767.1-3201s21c1
Sequence:CCGGACTGCCGATGAAGGTTGTATTCTCGAGAATACAACCTTCATCGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks