EMAIL THIS PAGE TO A FRIEND

CCDC63

coiled-coil domain containing 63

51 Gene Product Result for
Synonyms: ODA5
UniProtKB ID: Q8NA47, Q0P603, Q6P2E1
Gene ID:
Mouse(330188) coiled-coil domain containing 63
Rat(304484) coiled-coil domain containing 63
sheep(101106546) coiled-coil domain containing 63
domestic guinea pig(100719382) coiled-coil domain containing 63
naked mole-rat(101726480) coiled-coil domain containing 63
chicken(416873) coiled-coil domain containing 63
cow(518001) coiled-coil domain containing 63
domestic cat(101081255) coiled-coil domain containing 63
dog(477479) coiled-coil domain containing 63
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_183307 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183307 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183307 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152591 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152591 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152591 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152591 Rosetta Predictions human pricing
NM_001025665 Rosetta Predictions rat pricing
NM_183307 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152591 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00366430 predicted 1039
2 SASI_Hs01_00068619 predicted 1462
3 SASI_Hs01_00068620 predicted 1398
4 SASI_Hs01_00068621 predicted 877
5 SASI_Hs01_00068622 predicted 887
6 SASI_Hs01_00068623 predicted 957
7 SASI_Hs01_00068624 predicted 1503
8 SASI_Hs02_00366431 predicted 1505
9 SASI_Hs01_00068625 predicted 1314
10 SASI_Hs01_00068627 predicted 1254
11 SASI_Hs01_00068626 predicted 820
12 SASI_Hs01_00068628 predicted 1144
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025665 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00069743 predicted 922
2 SASI_Rn01_00069744 predicted 775
3 SASI_Rn01_00069745 predicted 1224
4 SASI_Rn01_00069746 predicted 468
5 SASI_Rn01_00069747 predicted 1082
6 SASI_Rn01_00069748 predicted 998
7 SASI_Rn01_00069749 predicted 1483
8 SASI_Rn01_00069750 predicted 1473
9 SASI_Rn01_00069751 predicted 452
10 SASI_Rn01_00069752 predicted 827
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183307 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00151322 predicted 1904
2 SASI_Mm01_00151323 predicted 1166
3 SASI_Mm01_00151324 predicted 702
4 SASI_Mm01_00151325 predicted 1086
5 SASI_Mm01_00151326 predicted 969
6 SASI_Mm01_00151327 predicted 1351
7 SASI_Mm01_00151328 predicted 961
8 SASI_Mm01_00151329 predicted 717
9 SASI_Mm01_00151330 predicted 1556
10 SASI_Mm01_00151331 predicted 1149
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183307
CCDC63 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 63
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183307.3-1388s21c1
Sequence:CCGGGAAGCAGGAAGATGTCAAATCCTCGAGGATTTGACATCTTCCTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216412    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183307.3-905s1c1
Sequence:CCGGGGATGATAAGATCGTTCAGATCTCGAGATCTGAACGATCTTATCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183307.3-905s21c1
Sequence:CCGGGGATGATAAGATCGTTCAGATCTCGAGATCTGAACGATCTTATCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183307.3-963s21c1
Sequence:CCGGAGGACACAAGAGGCCAATAATCTCGAGATTATTGGCCTCTTGTGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183307.3-1292s21c1
Sequence:CCGGCCGGGAACTGGAACGTCTATACTCGAGTATAGACGTTCCAGTTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183307.3-1338s21c1
Sequence:CCGGTTCCTGCTGGCCAAGCTTAACCTCGAGGTTAAGCTTGGCCAGCAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192958    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183307.1-1393s1c1
Sequence:CCGGGCAGGAAGATGTCAAATCCAACTCGAGTTGGATTTGACATCTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190225    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183307.1-1321s1c1
Sequence:CCGGCGAGACGAAACTCAAGTCCTTCTCGAGAAGGACTTGAGTTTCGTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191612    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183307.1-1264s1c1
Sequence:CCGGGAAAGACATCTCTCAGTACAACTCGAGTTGTACTGAGAGATGTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183307
CCDC63 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 63
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183307.3-1388s21c1
Sequence:CCGGGAAGCAGGAAGATGTCAAATCCTCGAGGATTTGACATCTTCCTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216412    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183307.3-905s1c1
Sequence:CCGGGGATGATAAGATCGTTCAGATCTCGAGATCTGAACGATCTTATCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183307.3-905s21c1
Sequence:CCGGGGATGATAAGATCGTTCAGATCTCGAGATCTGAACGATCTTATCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183307.3-963s21c1
Sequence:CCGGAGGACACAAGAGGCCAATAATCTCGAGATTATTGGCCTCTTGTGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183307.3-1292s21c1
Sequence:CCGGCCGGGAACTGGAACGTCTATACTCGAGTATAGACGTTCCAGTTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183307.3-1338s21c1
Sequence:CCGGTTCCTGCTGGCCAAGCTTAACCTCGAGGTTAAGCTTGGCCAGCAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192958    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183307.1-1393s1c1
Sequence:CCGGGCAGGAAGATGTCAAATCCAACTCGAGTTGGATTTGACATCTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190225    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183307.1-1321s1c1
Sequence:CCGGCGAGACGAAACTCAAGTCCTTCTCGAGAAGGACTTGAGTTTCGTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191612    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183307.1-1264s1c1
Sequence:CCGGGAAAGACATCTCTCAGTACAACTCGAGTTGTACTGAGAGATGTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183307
CCDC63 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 63
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183307.3-1388s21c1
Sequence:CCGGGAAGCAGGAAGATGTCAAATCCTCGAGGATTTGACATCTTCCTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216412    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183307.3-905s1c1
Sequence:CCGGGGATGATAAGATCGTTCAGATCTCGAGATCTGAACGATCTTATCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183307.3-905s21c1
Sequence:CCGGGGATGATAAGATCGTTCAGATCTCGAGATCTGAACGATCTTATCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183307.3-963s21c1
Sequence:CCGGAGGACACAAGAGGCCAATAATCTCGAGATTATTGGCCTCTTGTGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183307.3-1292s21c1
Sequence:CCGGCCGGGAACTGGAACGTCTATACTCGAGTATAGACGTTCCAGTTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183307.3-1338s21c1
Sequence:CCGGTTCCTGCTGGCCAAGCTTAACCTCGAGGTTAAGCTTGGCCAGCAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192958    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183307.1-1393s1c1
Sequence:CCGGGCAGGAAGATGTCAAATCCAACTCGAGTTGGATTTGACATCTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190225    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183307.1-1321s1c1
Sequence:CCGGCGAGACGAAACTCAAGTCCTTCTCGAGAAGGACTTGAGTTTCGTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191612    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183307.1-1264s1c1
Sequence:CCGGGAAAGACATCTCTCAGTACAACTCGAGTTGTACTGAGAGATGTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152591
CCDC63 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 63
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138931    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152591.1-1513s1c1
Sequence:CCGGGACATCAACCTTCCGCAGTATCTCGAGATACTGCGGAAGGTTGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138512    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152591.1-921s1c1
Sequence:CCGGCTCTCAGTACAACCTGGAGATCTCGAGATCTCCAGGTTGTACTGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138390    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152591.1-996s1c1
Sequence:CCGGCGTCAAGCTGAATGATCGCAACTCGAGTTGCGATCATTCAGCTTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138373    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152591.1-375s1c1
Sequence:CCGGCAAGGAGATCAAGACCCTGAACTCGAGTTCAGGGTCTTGATCTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152591.1-492s1c1
Sequence:CCGGGCTCCAAACTAAGGAGGACTACTCGAGTAGTCCTCCTTAGTTTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135849    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152591.1-1150s1c1
Sequence:CCGGCTAAACCAGCTCATTGAAGATCTCGAGATCTTCAATGAGCTGGTTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152591.1-736s1c1
Sequence:CCGGGAGATTGAAGACCTACGATTTCTCGAGAAATCGTAGGTCTTCAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152591.1-1785s1c1
Sequence:CCGGCGACAATTATATCCTGAAGGACTCGAGTCCTTCAGGATATAATTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152591.1-354s1c1
Sequence:CCGGGCAGAAGATTGCGAGTCAGTACTCGAGTACTGACTCGCAATCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138107    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152591.1-342s1c1
Sequence:CCGGGTTCCGAAACCAGCAGAAGATCTCGAGATCTTCTGCTGGTTTCGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152591.1-1294s1c1
Sequence:CCGGCAGCAGAAATTGTCCCACGATCTCGAGATCGTGGGACAATTTCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138833    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152591.1-1296s1c1
Sequence:CCGGGCAGAAATTGTCCCACGATGACTCGAGTCATCGTGGGACAATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152591
CCDC63 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 63
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138931    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152591.1-1513s1c1
Sequence:CCGGGACATCAACCTTCCGCAGTATCTCGAGATACTGCGGAAGGTTGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138512    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152591.1-921s1c1
Sequence:CCGGCTCTCAGTACAACCTGGAGATCTCGAGATCTCCAGGTTGTACTGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138390    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152591.1-996s1c1
Sequence:CCGGCGTCAAGCTGAATGATCGCAACTCGAGTTGCGATCATTCAGCTTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138373    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152591.1-375s1c1
Sequence:CCGGCAAGGAGATCAAGACCCTGAACTCGAGTTCAGGGTCTTGATCTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152591.1-492s1c1
Sequence:CCGGGCTCCAAACTAAGGAGGACTACTCGAGTAGTCCTCCTTAGTTTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135849    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152591.1-1150s1c1
Sequence:CCGGCTAAACCAGCTCATTGAAGATCTCGAGATCTTCAATGAGCTGGTTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152591.1-736s1c1
Sequence:CCGGGAGATTGAAGACCTACGATTTCTCGAGAAATCGTAGGTCTTCAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152591.1-1785s1c1
Sequence:CCGGCGACAATTATATCCTGAAGGACTCGAGTCCTTCAGGATATAATTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152591.1-354s1c1
Sequence:CCGGGCAGAAGATTGCGAGTCAGTACTCGAGTACTGACTCGCAATCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138107    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152591.1-342s1c1
Sequence:CCGGGTTCCGAAACCAGCAGAAGATCTCGAGATCTTCTGCTGGTTTCGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152591.1-1294s1c1
Sequence:CCGGCAGCAGAAATTGTCCCACGATCTCGAGATCGTGGGACAATTTCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138833    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152591.1-1296s1c1
Sequence:CCGGGCAGAAATTGTCCCACGATGACTCGAGTCATCGTGGGACAATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152591
CCDC63 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 63
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138931    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152591.1-1513s1c1
Sequence:CCGGGACATCAACCTTCCGCAGTATCTCGAGATACTGCGGAAGGTTGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138512    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152591.1-921s1c1
Sequence:CCGGCTCTCAGTACAACCTGGAGATCTCGAGATCTCCAGGTTGTACTGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138390    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152591.1-996s1c1
Sequence:CCGGCGTCAAGCTGAATGATCGCAACTCGAGTTGCGATCATTCAGCTTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138373    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152591.1-375s1c1
Sequence:CCGGCAAGGAGATCAAGACCCTGAACTCGAGTTCAGGGTCTTGATCTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152591.1-492s1c1
Sequence:CCGGGCTCCAAACTAAGGAGGACTACTCGAGTAGTCCTCCTTAGTTTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135849    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152591.1-1150s1c1
Sequence:CCGGCTAAACCAGCTCATTGAAGATCTCGAGATCTTCAATGAGCTGGTTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152591.1-736s1c1
Sequence:CCGGGAGATTGAAGACCTACGATTTCTCGAGAAATCGTAGGTCTTCAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152591.1-1785s1c1
Sequence:CCGGCGACAATTATATCCTGAAGGACTCGAGTCCTTCAGGATATAATTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152591.1-354s1c1
Sequence:CCGGGCAGAAGATTGCGAGTCAGTACTCGAGTACTGACTCGCAATCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138107    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152591.1-342s1c1
Sequence:CCGGGTTCCGAAACCAGCAGAAGATCTCGAGATCTTCTGCTGGTTTCGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152591.1-1294s1c1
Sequence:CCGGCAGCAGAAATTGTCCCACGATCTCGAGATCGTGGGACAATTTCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138833    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152591.1-1296s1c1
Sequence:CCGGGCAGAAATTGTCCCACGATGACTCGAGTCATCGTGGGACAATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks