EMAIL THIS PAGE TO A FRIEND

CCDC64

coiled-coil domain containing 64

90 Gene Product Result for
Synonyms: BICDR-1 H_267D11.1
UniProtKB ID: Q6ZP65, A8MUC8, O95000
Gene ID:
Mouse(75665) coiled-coil domain containing 64
Rat(304537) coiled-coil domain containing 64
chicken(770422) coiled-coil domain containing 64
cow(536747) coiled-coil domain containing 64
Horse(100054012) coiled-coil domain containing 64
domestic cat(101101596) coiled-coil domain containing 64
dog(100684686) coiled-coil domain containing 64
naked mole-rat(101703698) coiled-coil domain containing 64
domestic guinea pig(100731882) coiled-coil domain containing 64
sheep(101116936) coiled-coil domain containing 64
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207311 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207311 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207311 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001080808 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001080808 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001080808 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU140501 MISSION® esiRNA esiRNA human CCDC64 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207311 Rosetta Predictions human pricing
XM_001080211 Rosetta Predictions rat pricing
XM_222240 Rosetta Predictions rat pricing
NM_001080808 Rosetta Predictions mouse pricing
XM_132372 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207311 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182900 predicted 467
2 SASI_Hs02_00373836 predicted 431
3 SASI_Hs02_00373837 predicted 1502
4 SASI_Hs02_00373838 predicted 452
5 SASI_Hs01_00182907 predicted 710
6 SASI_Hs02_00373839 predicted 1147
7 SASI_Hs02_00373840 predicted 1176
8 SASI_Hs02_00373841 predicted 1591
9 SASI_Hs02_00373842 predicted 632
10 SASI_Hs02_00373843 predicted 737
11 SASI_Hs01_00182901 predicted 733
12 SASI_Hs01_00182902 predicted 1104
13 SASI_Hs01_00182903 predicted 992
14 SASI_Hs01_00182904 predicted 1235
15 SASI_Hs01_00182905 predicted 1157
16 SASI_Hs01_00182906 predicted 1283
17 SASI_Hs01_00182908 predicted 464
18 SASI_Hs01_00182909 predicted 638
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080211 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00367078 predicted 1625
2 SASI_Rn02_00367079 predicted 1592
3 SASI_Rn02_00367080 predicted 1395
4 SASI_Rn02_00367081 predicted 686
5 SASI_Rn02_00367082 predicted 1132
6 SASI_Rn02_00367083 predicted 267
7 SASI_Rn02_00367084 predicted 1095
8 SASI_Rn02_00367085 predicted 608
9 SASI_Rn02_00367086 predicted 609
10 SASI_Rn02_00367087 predicted 1695
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_222240 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00380675 predicted 666
2 SASI_Rn02_00380676 predicted 1494
3 SASI_Rn02_00380677 predicted 725
4 SASI_Rn02_00380678 predicted 1137
5 SASI_Rn02_00380679 predicted 2351
6 SASI_Rn02_00380680 predicted 1829
7 SASI_Rn02_00380681 predicted 1737
8 SASI_Rn02_00380682 predicted 1165
9 SASI_Rn02_00380683 predicted 642
10 SASI_Rn02_00380684 predicted 1150
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080808 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293823 predicted 670
2 SASI_Mm02_00293824 predicted 425
3 SASI_Mm02_00293825 predicted 1113
4 SASI_Mm02_00293826 predicted 1124
5 SASI_Mm02_00293827 predicted 1597
6 SASI_Mm02_00293828 predicted 426
7 SASI_Mm02_00293829 predicted 462
8 SASI_Mm02_00293830 predicted 1141
9 SASI_Mm02_00293831 predicted 1169
10 SASI_Mm02_00293832 predicted 908
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_132372 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00208439 predicted 684
2 SASI_Mm01_00208440 predicted 1497
3 SASI_Mm01_00208441 predicted 427
4 SASI_Mm01_00208442 predicted 1729
5 SASI_Mm01_00208443 predicted 1715
6 SASI_Mm01_00208444 predicted 1616
7 SASI_Mm01_00208445 predicted 433
8 SASI_Mm01_00208446 predicted 473
9 SASI_Mm01_00208447 predicted 1482
10 SASI_Mm01_00208448 predicted 1852
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207311
CCDC64 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 64
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207311.1-682s1c1
Sequence:CCGGCTCATCAACCAACCAGCACATCTCGAGATGTGCTGGTTGGTTGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155599    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207311.1-727s1c1
Sequence:CCGGCGAGATCAAGATGCTGTCAGACTCGAGTCTGACAGCATCTTGATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207311.1-586s1c1
Sequence:CCGGCCAAAGGCTATTGGATCAGCTCTCGAGAGCTGATCCAATAGCCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207311.1-370s1c1
Sequence:CCGGGCATAAGGAGCTGACAGACAACTCGAGTTGTCTGTCAGCTCCTTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207311.1-479s1c1
Sequence:CCGGGAGAGTGATGTGAAGCAGCTACTCGAGTAGCTGCTTCACATCACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207311.1-576s1c1
Sequence:CCGGCGGAACAGAACCAAAGGCTATCTCGAGATAGCCTTTGGTTCTGTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207311.2-588s21c1
Sequence:CCGGTGCGGGAAGCAGATCGAGAAACTCGAGTTTCTCGATCTGCTTCCCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207311.2-474s21c1
Sequence:CCGGATGAATTGAGAAGACGATTTGCTCGAGCAAATCGTCTTCTCAATTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207311.2-1490s21c1
Sequence:CCGGGCCAAGTGCAGGATGGATATGCTCGAGCATATCCATCCTGCACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207311
CCDC64 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 64
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207311.1-682s1c1
Sequence:CCGGCTCATCAACCAACCAGCACATCTCGAGATGTGCTGGTTGGTTGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155599    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207311.1-727s1c1
Sequence:CCGGCGAGATCAAGATGCTGTCAGACTCGAGTCTGACAGCATCTTGATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207311.1-586s1c1
Sequence:CCGGCCAAAGGCTATTGGATCAGCTCTCGAGAGCTGATCCAATAGCCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207311.1-370s1c1
Sequence:CCGGGCATAAGGAGCTGACAGACAACTCGAGTTGTCTGTCAGCTCCTTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207311.1-479s1c1
Sequence:CCGGGAGAGTGATGTGAAGCAGCTACTCGAGTAGCTGCTTCACATCACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207311.1-576s1c1
Sequence:CCGGCGGAACAGAACCAAAGGCTATCTCGAGATAGCCTTTGGTTCTGTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207311.2-588s21c1
Sequence:CCGGTGCGGGAAGCAGATCGAGAAACTCGAGTTTCTCGATCTGCTTCCCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207311.2-474s21c1
Sequence:CCGGATGAATTGAGAAGACGATTTGCTCGAGCAAATCGTCTTCTCAATTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207311.2-1490s21c1
Sequence:CCGGGCCAAGTGCAGGATGGATATGCTCGAGCATATCCATCCTGCACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207311
CCDC64 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 64
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207311.1-682s1c1
Sequence:CCGGCTCATCAACCAACCAGCACATCTCGAGATGTGCTGGTTGGTTGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155599    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207311.1-727s1c1
Sequence:CCGGCGAGATCAAGATGCTGTCAGACTCGAGTCTGACAGCATCTTGATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207311.1-586s1c1
Sequence:CCGGCCAAAGGCTATTGGATCAGCTCTCGAGAGCTGATCCAATAGCCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207311.1-370s1c1
Sequence:CCGGGCATAAGGAGCTGACAGACAACTCGAGTTGTCTGTCAGCTCCTTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207311.1-479s1c1
Sequence:CCGGGAGAGTGATGTGAAGCAGCTACTCGAGTAGCTGCTTCACATCACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207311.1-576s1c1
Sequence:CCGGCGGAACAGAACCAAAGGCTATCTCGAGATAGCCTTTGGTTCTGTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207311.2-588s21c1
Sequence:CCGGTGCGGGAAGCAGATCGAGAAACTCGAGTTTCTCGATCTGCTTCCCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207311.2-474s21c1
Sequence:CCGGATGAATTGAGAAGACGATTTGCTCGAGCAAATCGTCTTCTCAATTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207311.2-1490s21c1
Sequence:CCGGGCCAAGTGCAGGATGGATATGCTCGAGCATATCCATCCTGCACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080808
CCDC64 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 64
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080808.1-464s21c1
Sequence:CCGGTGAGAAGGCGATTCGAGAATCCTCGAGGATTCTCGAATCGCCTTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080808.1-1268s21c1
Sequence:CCGGACGATCTCAAGAGGCTGATACCTCGAGGTATCAGCCTCTTGAGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080808.1-1120s21c1
Sequence:CCGGGCCTACTGCCAGGTTCGATATCTCGAGATATCGAACCTGGCAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080808.1-724s21c1
Sequence:CCGGTCCTCCACCAACCAGCATATCCTCGAGGATATGCTGGTTGGTGGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080808.1-1473s21c1
Sequence:CCGGCGCCAAGTGCAAGATGGATATCTCGAGATATCCATCTTGCACTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080808
CCDC64 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 64
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080808.1-464s21c1
Sequence:CCGGTGAGAAGGCGATTCGAGAATCCTCGAGGATTCTCGAATCGCCTTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080808.1-1268s21c1
Sequence:CCGGACGATCTCAAGAGGCTGATACCTCGAGGTATCAGCCTCTTGAGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080808.1-1120s21c1
Sequence:CCGGGCCTACTGCCAGGTTCGATATCTCGAGATATCGAACCTGGCAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080808.1-724s21c1
Sequence:CCGGTCCTCCACCAACCAGCATATCCTCGAGGATATGCTGGTTGGTGGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080808.1-1473s21c1
Sequence:CCGGCGCCAAGTGCAAGATGGATATCTCGAGATATCCATCTTGCACTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080808
CCDC64 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 64
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080808.1-464s21c1
Sequence:CCGGTGAGAAGGCGATTCGAGAATCCTCGAGGATTCTCGAATCGCCTTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080808.1-1268s21c1
Sequence:CCGGACGATCTCAAGAGGCTGATACCTCGAGGTATCAGCCTCTTGAGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080808.1-1120s21c1
Sequence:CCGGGCCTACTGCCAGGTTCGATATCTCGAGATATCGAACCTGGCAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080808.1-724s21c1
Sequence:CCGGTCCTCCACCAACCAGCATATCCTCGAGGATATGCTGGTTGGTGGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080808.1-1473s21c1
Sequence:CCGGCGCCAAGTGCAAGATGGATATCTCGAGATATCCATCTTGCACTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks