EMAIL THIS PAGE TO A FRIEND

CCDC64B

coiled-coil domain containing 64B

Synonyms: BICDR-2
UniProtKB ID: A1A5D9, Q658L9
Gene ID:
Mouse(212733) coiled-coil domain containing 64B
Rat(302964) coiled-coil domain containing 64B
sheep(101118239) coiled-coil domain containing 64B
domestic guinea pig(100712870) coiled-coil domain containing 64B
naked mole-rat(101725507) coiled-coil domain containing 64B
dog(490047) coiled-coil domain containing 64B
domestic cat(101099350) coiled-coil domain containing 64B
cow(507073) coiled-coil domain containing 64B
51 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA043251 Anti-CCDC64B antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001103175 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001103175 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001103175 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153784 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153784 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153784 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU000801 MISSION® esiRNA esiRNA targeting mouse Ccdc64b (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001103175 Rosetta Predictions human pricing
XM_085463 Rosetta Predictions human pricing
NM_001106982 Rosetta Predictions rat pricing
NM_153784 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001103175 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323653 predicted 798
2 SASI_Hs02_00323654 predicted 247
3 SASI_Hs02_00323655 predicted 554
4 SASI_Hs02_00323656 predicted 1533
5 SASI_Hs02_00323657 predicted 547
6 SASI_Hs02_00323658 predicted 1091
7 SASI_Hs02_00323659 predicted 1318
8 SASI_Hs02_00323660 predicted 248
9 SASI_Hs02_00323661 predicted 1544
10 SASI_Hs02_00323662 predicted 563
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_085463 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00261998 predicted 821
2 SASI_Hs01_00261999 predicted 319
3 SASI_Hs01_00262000 predicted 266
4 SASI_Hs01_00262001 predicted 573
5 SASI_Hs01_00262002 predicted 1547
6 SASI_Hs01_00262003 predicted 639
7 SASI_Hs01_00262004 predicted 1344
8 SASI_Hs01_00262005 predicted 266
9 SASI_Hs01_00262006 predicted 1561
10 SASI_Hs01_00262007 predicted 1550
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106982 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00224316 predicted 1563
2 SASI_Rn02_00224317 predicted 665
3 SASI_Rn02_00224318 predicted 220
4 SASI_Rn02_00224319 predicted 1001
5 SASI_Rn02_00224320 predicted 1371
6 SASI_Rn02_00224321 predicted 1211
7 SASI_Rn02_00224322 predicted 735
8 SASI_Rn02_00224323 predicted 1341
9 SASI_Rn02_00224324 predicted 800
10 SASI_Rn02_00224325 predicted 1307
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153784 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00131749 predicted 319
2 SASI_Mm02_00343507 predicted 1152
3 SASI_Mm01_00131750 predicted 1257
4 SASI_Mm01_00131751 predicted 965
5 SASI_Mm01_00131752 predicted 890
6 SASI_Mm01_00131754 predicted 1587
7 SASI_Mm01_00131755 predicted 693
8 SASI_Mm01_00131756 predicted 1290
9 SASI_Mm01_00131757 predicted 757
10 SASI_Mm01_00131758 predicted 1057
11 SASI_Mm01_00131753 predicted 1564
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001103175
CCDC64B MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 64B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001103175.1-251s21c1
Sequence:CCGGAGATGCTTCTGGAGCGAAATGCTCGAGCATTTCGCTCCAGAAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001103175.1-1129s21c1
Sequence:CCGGGAAGTGGCCAAGCTGCAAGATCTCGAGATCTTGCAGCTTGGCCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001103175.1-921s21c1
Sequence:CCGGTGCCTCGTTGCAGTCAGAACTCTCGAGAGTTCTGACTGCAACGAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001103175.1-549s21c1
Sequence:CCGGCCAGACTGAGCAGGAACTTCACTCGAGTGAAGTTCCTGCTCAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254042    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001103175.1-1614s21c1
Sequence:CCGGACTTTCCTCTTCAGGCCAATGCTCGAGCATTGGCCTGAAGAGGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001103175
CCDC64B MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 64B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001103175.1-251s21c1
Sequence:CCGGAGATGCTTCTGGAGCGAAATGCTCGAGCATTTCGCTCCAGAAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001103175.1-1129s21c1
Sequence:CCGGGAAGTGGCCAAGCTGCAAGATCTCGAGATCTTGCAGCTTGGCCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001103175.1-921s21c1
Sequence:CCGGTGCCTCGTTGCAGTCAGAACTCTCGAGAGTTCTGACTGCAACGAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001103175.1-549s21c1
Sequence:CCGGCCAGACTGAGCAGGAACTTCACTCGAGTGAAGTTCCTGCTCAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254042    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001103175.1-1614s21c1
Sequence:CCGGACTTTCCTCTTCAGGCCAATGCTCGAGCATTGGCCTGAAGAGGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001103175
CCDC64B MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 64B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001103175.1-251s21c1
Sequence:CCGGAGATGCTTCTGGAGCGAAATGCTCGAGCATTTCGCTCCAGAAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001103175.1-1129s21c1
Sequence:CCGGGAAGTGGCCAAGCTGCAAGATCTCGAGATCTTGCAGCTTGGCCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001103175.1-921s21c1
Sequence:CCGGTGCCTCGTTGCAGTCAGAACTCTCGAGAGTTCTGACTGCAACGAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001103175.1-549s21c1
Sequence:CCGGCCAGACTGAGCAGGAACTTCACTCGAGTGAAGTTCCTGCTCAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254042    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001103175.1-1614s21c1
Sequence:CCGGACTTTCCTCTTCAGGCCAATGCTCGAGCATTGGCCTGAAGAGGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153784
CCDC64B MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 64B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000196097    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153784.1-795s1c1
Sequence:CCGGGCTGCTTCGTAGAGAGAGAAACTCGAGTTTCTCTCTCTACGAAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153784.1-349s1c1
Sequence:CCGGGAAAGGCTACAGCAGGAGAATCTCGAGATTCTCCTGCTGTAGCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153784.1-736s1c1
Sequence:CCGGCTTCGTGAAGAAGTGGACAAACTCGAGTTTGTCCACTTCTTCACGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180391    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153784.1-1630s1c1
Sequence:CCGGGCTCAATTTCCTAACAGCCAACTCGAGTTGGCTGTTAGGAAATTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153784.1-1071s1c1
Sequence:CCGGGCCTTCAATACAGGAAGAGATCTCGAGATCTCTTCCTGTATTGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153784
CCDC64B MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 64B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000196097    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153784.1-795s1c1
Sequence:CCGGGCTGCTTCGTAGAGAGAGAAACTCGAGTTTCTCTCTCTACGAAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153784.1-349s1c1
Sequence:CCGGGAAAGGCTACAGCAGGAGAATCTCGAGATTCTCCTGCTGTAGCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153784.1-736s1c1
Sequence:CCGGCTTCGTGAAGAAGTGGACAAACTCGAGTTTGTCCACTTCTTCACGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180391    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153784.1-1630s1c1
Sequence:CCGGGCTCAATTTCCTAACAGCCAACTCGAGTTGGCTGTTAGGAAATTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153784.1-1071s1c1
Sequence:CCGGGCCTTCAATACAGGAAGAGATCTCGAGATCTCTTCCTGTATTGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153784
CCDC64B MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 64B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000196097    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153784.1-795s1c1
Sequence:CCGGGCTGCTTCGTAGAGAGAGAAACTCGAGTTTCTCTCTCTACGAAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153784.1-349s1c1
Sequence:CCGGGAAAGGCTACAGCAGGAGAATCTCGAGATTCTCCTGCTGTAGCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153784.1-736s1c1
Sequence:CCGGCTTCGTGAAGAAGTGGACAAACTCGAGTTTGTCCACTTCTTCACGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180391    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153784.1-1630s1c1
Sequence:CCGGGCTCAATTTCCTAACAGCCAACTCGAGTTGGCTGTTAGGAAATTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153784.1-1071s1c1
Sequence:CCGGGCCTTCAATACAGGAAGAGATCTCGAGATCTCTTCCTGTATTGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks