EMAIL THIS PAGE TO A FRIEND

CCDC65

coiled-coil domain containing 65

49 Gene Product Result for
Synonyms: NYD-SP28
UniProtKB ID: Q8IXS2, A6NJG5, B2RBE2, Q8N7G4, Q8NA91, Q96JA0
Gene ID:
Human(85478) Summary: CCDC65 is a sperm tail protein that is posttranslationally modified during sperm capacitation (Zheng et al., 2006 [PubMed 17089017]
Mouse(105833) coiled-coil domain containing 65
Rat(362994) coiled-coil domain containing 65
Zebrafish(368824) coiled-coil domain containing 65
domestic cat(101092864) coiled-coil domain containing 65
cow(535207) coiled-coil domain containing 65
dog(477622) coiled-coil domain containing 65
chicken(429591) coiled-coil domain containing 65
naked mole-rat(101725118) coiled-coil domain containing 65
domestic guinea pig(100717302) coiled-coil domain containing 65
sheep(101104220) coiled-coil domain containing 65
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153518 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153518 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153518 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_033124 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033124 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033124 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033124 Rosetta Predictions human pricing
NM_001014203 Rosetta Predictions rat pricing
NM_153518 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033124 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00046845 predicted 1045
2 SASI_Hs01_00046846 predicted 1425
3 SASI_Hs01_00046847 predicted 955
4 SASI_Hs01_00046848 predicted 874
5 SASI_Hs01_00046849 predicted 1023
6 SASI_Hs01_00046850 predicted 856
7 SASI_Hs01_00046851 predicted 1192
8 SASI_Hs01_00046852 predicted 474
9 SASI_Hs01_00046853 predicted 1222
10 SASI_Hs01_00046854 predicted 654
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014203 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00201727 predicted 598
2 SASI_Rn01_00111906 predicted 575
3 SASI_Rn01_00111907 predicted 1164
4 SASI_Rn01_00111908 predicted 603
5 SASI_Rn01_00111909 predicted 1161
6 SASI_Rn01_00111910 predicted 412
7 SASI_Rn01_00111911 predicted 408
8 SASI_Rn01_00111912 predicted 1358
9 SASI_Rn01_00111913 predicted 1071
10 SASI_Rn01_00111914 predicted 985
11 SASI_Rn01_00111915 predicted 577
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153518 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00082810 predicted 804
2 SASI_Mm01_00082811 predicted 1042
3 SASI_Mm01_00082812 predicted 458
4 SASI_Mm01_00082813 predicted 647
5 SASI_Mm02_00343277 predicted 894
6 SASI_Mm01_00082814 predicted 1351
7 SASI_Mm01_00082815 predicted 1122
8 SASI_Mm01_00082816 predicted 1401
9 SASI_Mm01_00082817 predicted 618
10 SASI_Mm01_00082818 predicted 1594
11 SASI_Mm01_00082819 predicted 472
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153518
CCDC65 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 65
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000201748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153518.1-947s1c1
Sequence:CCGGGAGATTGAGACGCAGATGAAACTCGAGTTTCATCTGCGTCTCAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189760    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153518.1-1728s1c1
Sequence:CCGGGCTTTGCTCTCATGCTCAGATCTCGAGATCTGAGCATGAGAGCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153518.1-715s1c1
Sequence:CCGGGCAGAACTACATAGATTCCGACTCGAGTCGGAATCTATGTAGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153518.1-1222s1c1
Sequence:CCGGGCTTGCTGAAATATGTAGGAACTCGAGTTCCTACATATTTCAGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153518
CCDC65 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 65
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000201748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153518.1-947s1c1
Sequence:CCGGGAGATTGAGACGCAGATGAAACTCGAGTTTCATCTGCGTCTCAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189760    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153518.1-1728s1c1
Sequence:CCGGGCTTTGCTCTCATGCTCAGATCTCGAGATCTGAGCATGAGAGCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153518.1-715s1c1
Sequence:CCGGGCAGAACTACATAGATTCCGACTCGAGTCGGAATCTATGTAGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153518.1-1222s1c1
Sequence:CCGGGCTTGCTGAAATATGTAGGAACTCGAGTTCCTACATATTTCAGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153518
CCDC65 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 65
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000201748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153518.1-947s1c1
Sequence:CCGGGAGATTGAGACGCAGATGAAACTCGAGTTTCATCTGCGTCTCAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189760    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153518.1-1728s1c1
Sequence:CCGGGCTTTGCTCTCATGCTCAGATCTCGAGATCTGAGCATGAGAGCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153518.1-715s1c1
Sequence:CCGGGCAGAACTACATAGATTCCGACTCGAGTCGGAATCTATGTAGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153518.1-1222s1c1
Sequence:CCGGGCTTGCTGAAATATGTAGGAACTCGAGTTCCTACATATTTCAGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033124
CCDC65 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 65
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033124.2-243s1c1
Sequence:CCGGGCTGCTTCTGTTTCAGCAGAACTCGAGTTCTGCTGAAACAGAAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033124.2-1545s1c1
Sequence:CCGGCCAGCTCAACCCACTCTTTATCTCGAGATAAAGAGTGGGTTGAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033124.2-641s1c1
Sequence:CCGGCCAAGGAGTTTGAGACAGAAACTCGAGTTTCTGTCTCAAACTCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033124.2-447s1c1
Sequence:CCGGCCAAACATTTGAACGAGTGGTCTCGAGACCACTCGTTCAAATGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033124.2-705s1c1
Sequence:CCGGGCAAGATATCTTCATGGCCATCTCGAGATGGCCATGAAGATATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033124.4-1092s21c1
Sequence:CCGGGAGAACCGGTATATCCGTAATCTCGAGATTACGGATATACCGGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033124.4-1490s21c1
Sequence:CCGGACGAGCCCAGCTGCTAGATATCTCGAGATATCTAGCAGCTGGGCTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033124.4-1264s21c1
Sequence:CCGGTCCTTAAACTTGCTGAAATATCTCGAGATATTTCAGCAAGTTTAAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033124.4-513s21c1
Sequence:CCGGGACAATGTCATCAAGTCTTTACTCGAGTAAAGACTTGATGACATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033124
CCDC65 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 65
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033124.2-243s1c1
Sequence:CCGGGCTGCTTCTGTTTCAGCAGAACTCGAGTTCTGCTGAAACAGAAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033124.2-1545s1c1
Sequence:CCGGCCAGCTCAACCCACTCTTTATCTCGAGATAAAGAGTGGGTTGAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033124.2-641s1c1
Sequence:CCGGCCAAGGAGTTTGAGACAGAAACTCGAGTTTCTGTCTCAAACTCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033124.2-447s1c1
Sequence:CCGGCCAAACATTTGAACGAGTGGTCTCGAGACCACTCGTTCAAATGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033124.2-705s1c1
Sequence:CCGGGCAAGATATCTTCATGGCCATCTCGAGATGGCCATGAAGATATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033124.4-1092s21c1
Sequence:CCGGGAGAACCGGTATATCCGTAATCTCGAGATTACGGATATACCGGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033124.4-1490s21c1
Sequence:CCGGACGAGCCCAGCTGCTAGATATCTCGAGATATCTAGCAGCTGGGCTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033124.4-1264s21c1
Sequence:CCGGTCCTTAAACTTGCTGAAATATCTCGAGATATTTCAGCAAGTTTAAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033124.4-513s21c1
Sequence:CCGGGACAATGTCATCAAGTCTTTACTCGAGTAAAGACTTGATGACATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033124
CCDC65 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 65
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033124.2-243s1c1
Sequence:CCGGGCTGCTTCTGTTTCAGCAGAACTCGAGTTCTGCTGAAACAGAAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033124.2-1545s1c1
Sequence:CCGGCCAGCTCAACCCACTCTTTATCTCGAGATAAAGAGTGGGTTGAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033124.2-641s1c1
Sequence:CCGGCCAAGGAGTTTGAGACAGAAACTCGAGTTTCTGTCTCAAACTCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033124.2-447s1c1
Sequence:CCGGCCAAACATTTGAACGAGTGGTCTCGAGACCACTCGTTCAAATGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033124.2-705s1c1
Sequence:CCGGGCAAGATATCTTCATGGCCATCTCGAGATGGCCATGAAGATATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033124.4-1092s21c1
Sequence:CCGGGAGAACCGGTATATCCGTAATCTCGAGATTACGGATATACCGGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033124.4-1490s21c1
Sequence:CCGGACGAGCCCAGCTGCTAGATATCTCGAGATATCTAGCAGCTGGGCTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033124.4-1264s21c1
Sequence:CCGGTCCTTAAACTTGCTGAAATATCTCGAGATATTTCAGCAAGTTTAAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033124.4-513s21c1
Sequence:CCGGGACAATGTCATCAAGTCTTTACTCGAGTAAAGACTTGATGACATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks