EMAIL THIS PAGE TO A FRIEND

CCDC66

coiled-coil domain containing 66

122 Gene Product Result for
UniProtKB ID: A2RUB6, B3KWL8, Q4VC34, Q8N949
Gene ID:
Mouse(320234) coiled-coil domain containing 66
sheep(101104693) coiled-coil domain containing 66
domestic guinea pig(100722508) coiled-coil domain containing 66
naked mole-rat(101706340) coiled-coil domain containing 66
chicken(415997) coiled-coil domain containing 66
cow(534513) coiled-coil domain containing 66
Horse(100059039) coiled-coil domain containing 66
domestic cat(101095804) coiled-coil domain containing 66
dog(476582) coiled-coil domain containing 66
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001012506 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001012506 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001012506 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177111 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177111 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177111 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU070741 MISSION® esiRNA esiRNA targeting mouse Ccdc66 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012506 Rosetta Predictions human pricing
NM_177111 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012506 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00168364 predicted 1581
2 SASI_Hs01_00168365 predicted 1408
3 SASI_Hs01_00168366 predicted 1910
4 SASI_Hs01_00168367 predicted 2624
5 SASI_Hs01_00168368 predicted 1733
6 SASI_Hs01_00168369 predicted 627
7 SASI_Hs01_00168370 predicted 2527
8 SASI_Hs02_00306169 predicted 1940
9 SASI_Hs01_00168371 predicted 1262
10 SASI_Hs01_00168372 predicted 2517
11 SASI_Hs01_00168363 predicted 1344
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177111 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00046855 predicted 1332
2 SASI_Mm02_00347098 predicted 2070
3 SASI_Mm02_00347099 predicted 2395
4 SASI_Mm02_00347100 predicted 749
5 SASI_Mm02_00347101 predicted 2369
6 SASI_Mm02_00347102 predicted 2641
7 SASI_Mm02_00347103 predicted 2463
8 SASI_Mm02_00347104 predicted 2538
9 SASI_Mm02_00347105 predicted 1976
10 SASI_Mm02_00347106 predicted 2193
11 SASI_Mm01_00046853 predicted 1932
12 SASI_Mm01_00046854 predicted 1749
13 SASI_Mm01_00046856 predicted 1842
14 SASI_Mm01_00046857 predicted 1901
15 SASI_Mm01_00046858 predicted 915
16 SASI_Mm01_00046859 predicted 722
17 SASI_Mm01_00046860 predicted 1586
18 SASI_Mm01_00046861 predicted 916
19 SASI_Mm01_00046862 predicted 1743
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001012506
CCDC66 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 66
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000450143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012506.4-1794s21c1
Sequence:CCGGATGGAATATAATGCATCTAACCTCGAGGTTAGATGCATTATATTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000445479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012506.4-427s21c1
Sequence:CCGGAGACTAGAAACACCGTAAATACTCGAGTATTTACGGTGTTTCTAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012506.1-2777s1c1
Sequence:CCGGGATCGACAGCAAGCAATCCTTCTCGAGAAGGATTGCTTGCTGTCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012506.1-1076s1c1
Sequence:CCGGCAAATAGAAGATGACCGTCAACTCGAGTTGACGGTCATCTTCTATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012506.1-1989s1c1
Sequence:CCGGCTGAGATTTCGGCAGAACTTACTCGAGTAAGTTCTGCCGAAATCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012506.1-1028s1c1
Sequence:CCGGGCTGTGAAACAAGAACTGCAACTCGAGTTGCAGTTCTTGTTTCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166977    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012506.1-2925s1c1
Sequence:CCGGCCTTCACATTTGATTTGTGTCCTCGAGGACACAAATCAAATGTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001012506
CCDC66 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 66
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000450143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012506.4-1794s21c1
Sequence:CCGGATGGAATATAATGCATCTAACCTCGAGGTTAGATGCATTATATTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000445479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012506.4-427s21c1
Sequence:CCGGAGACTAGAAACACCGTAAATACTCGAGTATTTACGGTGTTTCTAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012506.1-2777s1c1
Sequence:CCGGGATCGACAGCAAGCAATCCTTCTCGAGAAGGATTGCTTGCTGTCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012506.1-1076s1c1
Sequence:CCGGCAAATAGAAGATGACCGTCAACTCGAGTTGACGGTCATCTTCTATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012506.1-1989s1c1
Sequence:CCGGCTGAGATTTCGGCAGAACTTACTCGAGTAAGTTCTGCCGAAATCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012506.1-1028s1c1
Sequence:CCGGGCTGTGAAACAAGAACTGCAACTCGAGTTGCAGTTCTTGTTTCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166977    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012506.1-2925s1c1
Sequence:CCGGCCTTCACATTTGATTTGTGTCCTCGAGGACACAAATCAAATGTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001012506
CCDC66 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 66
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000450143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012506.4-1794s21c1
Sequence:CCGGATGGAATATAATGCATCTAACCTCGAGGTTAGATGCATTATATTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000445479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012506.4-427s21c1
Sequence:CCGGAGACTAGAAACACCGTAAATACTCGAGTATTTACGGTGTTTCTAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012506.1-2777s1c1
Sequence:CCGGGATCGACAGCAAGCAATCCTTCTCGAGAAGGATTGCTTGCTGTCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012506.1-1076s1c1
Sequence:CCGGCAAATAGAAGATGACCGTCAACTCGAGTTGACGGTCATCTTCTATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012506.1-1989s1c1
Sequence:CCGGCTGAGATTTCGGCAGAACTTACTCGAGTAAGTTCTGCCGAAATCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012506.1-1028s1c1
Sequence:CCGGGCTGTGAAACAAGAACTGCAACTCGAGTTGCAGTTCTTGTTTCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166977    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012506.1-2925s1c1
Sequence:CCGGCCTTCACATTTGATTTGTGTCCTCGAGGACACAAATCAAATGTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177111
VALIDATED
CCDC66 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 66
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000215671    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177111.3-2669s1c1
Sequence:CCGGGATCCACTTCTTAATCCTAAACTCGAGTTTAGGATTAAGAAGTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215849    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177111.3-2540s1c1
Sequence:CCGGCGAACAAATGAGATCTATTATCTCGAGATAATAGATCTCATTTGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216852    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177111.3-1727s1c1
Sequence:CCGGGGTGCACAAGTGGATTATAAGCTCGAGCTTATAATCCACTTGTGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217446    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177111.3-2470s1c1
Sequence:CCGGGACTTTAGGAGATGGTCATACCTCGAGGTATGACCATCTCCTAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200694    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177111.1-1121s1c1
Sequence:CCGGGAACTCAACAAACTCAAAGTACTCGAGTACTTTGAGTTTGTTGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177111.1-1365s1c1
Sequence:CCGGGCTATTTGACTCTGACCATATCTCGAGATATGGTCAGAGTCAAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177111.1-555s1c1
Sequence:CCGGGCAGACAGATGACGTAAACTTCTCGAGAAGTTTACGTCATCTGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177111.1-933s1c1
Sequence:CCGGGCTTCACTTAGTGGAGAGAAACTCGAGTTTCTCTCCACTAAGTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177111.1-611s1c1
Sequence:CCGGCGGTAACAGAGAAGGGTATTACTCGAGTAATACCCTTCTCTGTTACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177111.1-1498s1c1
Sequence:CCGGGAAACGAATCTCATACCCTTACTCGAGTAAGGGTATGAGATTCGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177111
VALIDATED
CCDC66 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 66
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000215671    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177111.3-2669s1c1
Sequence:CCGGGATCCACTTCTTAATCCTAAACTCGAGTTTAGGATTAAGAAGTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215849    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177111.3-2540s1c1
Sequence:CCGGCGAACAAATGAGATCTATTATCTCGAGATAATAGATCTCATTTGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216852    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177111.3-1727s1c1
Sequence:CCGGGGTGCACAAGTGGATTATAAGCTCGAGCTTATAATCCACTTGTGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217446    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177111.3-2470s1c1
Sequence:CCGGGACTTTAGGAGATGGTCATACCTCGAGGTATGACCATCTCCTAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200694    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177111.1-1121s1c1
Sequence:CCGGGAACTCAACAAACTCAAAGTACTCGAGTACTTTGAGTTTGTTGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177111.1-1365s1c1
Sequence:CCGGGCTATTTGACTCTGACCATATCTCGAGATATGGTCAGAGTCAAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177111.1-555s1c1
Sequence:CCGGGCAGACAGATGACGTAAACTTCTCGAGAAGTTTACGTCATCTGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177111.1-933s1c1
Sequence:CCGGGCTTCACTTAGTGGAGAGAAACTCGAGTTTCTCTCCACTAAGTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177111.1-611s1c1
Sequence:CCGGCGGTAACAGAGAAGGGTATTACTCGAGTAATACCCTTCTCTGTTACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177111.1-1498s1c1
Sequence:CCGGGAAACGAATCTCATACCCTTACTCGAGTAAGGGTATGAGATTCGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177111
VALIDATED
CCDC66 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 66
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000215671    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177111.3-2669s1c1
Sequence:CCGGGATCCACTTCTTAATCCTAAACTCGAGTTTAGGATTAAGAAGTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215849    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177111.3-2540s1c1
Sequence:CCGGCGAACAAATGAGATCTATTATCTCGAGATAATAGATCTCATTTGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216852    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177111.3-1727s1c1
Sequence:CCGGGGTGCACAAGTGGATTATAAGCTCGAGCTTATAATCCACTTGTGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217446    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177111.3-2470s1c1
Sequence:CCGGGACTTTAGGAGATGGTCATACCTCGAGGTATGACCATCTCCTAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200694    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177111.1-1121s1c1
Sequence:CCGGGAACTCAACAAACTCAAAGTACTCGAGTACTTTGAGTTTGTTGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177111.1-1365s1c1
Sequence:CCGGGCTATTTGACTCTGACCATATCTCGAGATATGGTCAGAGTCAAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177111.1-555s1c1
Sequence:CCGGGCAGACAGATGACGTAAACTTCTCGAGAAGTTTACGTCATCTGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177111.1-933s1c1
Sequence:CCGGGCTTCACTTAGTGGAGAGAAACTCGAGTTTCTCTCCACTAAGTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177111.1-611s1c1
Sequence:CCGGCGGTAACAGAGAAGGGTATTACTCGAGTAATACCCTTCTCTGTTACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177111.1-1498s1c1
Sequence:CCGGGAAACGAATCTCATACCCTTACTCGAGTAAGGGTATGAGATTCGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks