EMAIL THIS PAGE TO A FRIEND

CCDC67

coiled-coil domain containing 67

108 Gene Product Result for
UniProtKB ID: Q05D60, Q8NEF1, Q96LL7
Gene ID:
Mouse(234964) coiled-coil domain containing 67
Rat(315438) coiled-coil domain containing 67
chicken(419006) coiled-coil domain containing 67
cow(537776) coiled-coil domain containing 67
Horse(100058898) coiled-coil domain containing 67
domestic cat(101083446) coiled-coil domain containing 67
dog(476771) coiled-coil domain containing 67
naked mole-rat(101703657) coiled-coil domain containing 67
domestic guinea pig(100723258) coiled-coil domain containing 67
sheep(101119682) coiled-coil domain containing 67
Domestic Rabbit(100352988) coiled-coil domain containing 67
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181645 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181645 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181645 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_181816 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181816 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181816 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU097581 MISSION® esiRNA esiRNA human CCDC67 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181645 Rosetta Predictions human pricing
NM_001014087 Rosetta Predictions rat pricing
NM_181816 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181645 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00100082 predicted 652
2 SASI_Hs01_00100084 predicted 309
3 SASI_Hs01_00100085 predicted 265
4 SASI_Hs02_00370218 predicted 549
5 SASI_Hs02_00370219 predicted 1700
6 SASI_Hs01_00100086 predicted 764
7 SASI_Hs01_00100087 predicted 742
8 SASI_Hs01_00100088 predicted 503
9 SASI_Hs02_00370220 predicted 1574
10 SASI_Hs01_00100090 predicted 577
11 SASI_Hs01_00100083 predicted 1155
12 SASI_Hs01_00100089 predicted 693
13 SASI_Hs01_00100091 predicted 1151
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014087 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00113259 predicted 264
2 SASI_Rn01_00113260 predicted 1078
3 SASI_Rn01_00113261 predicted 1308
4 SASI_Rn01_00113262 predicted 338
5 SASI_Rn01_00113263 predicted 1564
6 SASI_Rn01_00113264 predicted 1482
7 SASI_Rn01_00113265 predicted 368
8 SASI_Rn01_00113266 predicted 1298
9 SASI_Rn01_00113267 predicted 1352
10 SASI_Rn02_00201513 predicted 1438
11 SASI_Rn01_00113258 predicted 202
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181816 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00349927 predicted 1773
2 SASI_Mm02_00349928 predicted 229
3 SASI_Mm01_00183500 predicted 1225
4 SASI_Mm01_00183502 predicted 1016
5 SASI_Mm01_00183503 predicted 394
6 SASI_Mm02_00349929 predicted 284
7 SASI_Mm01_00183505 predicted 1338
8 SASI_Mm02_00349930 predicted 1645
9 SASI_Mm02_00349931 predicted 1471
10 SASI_Mm01_00183508 predicted 1148
11 SASI_Mm01_00183501 predicted 475
12 SASI_Mm01_00183504 predicted 1190
13 SASI_Mm01_00183506 predicted 332
14 SASI_Mm01_00183507 predicted 307
15 SASI_Mm01_00183509 predicted 1282
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181645
CCDC67 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 67
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168087    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181645.1-598s1c1
Sequence:CCGGCGTTTGATATGTGACCCAGATCTCGAGATCTGGGTCACATATCAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167871    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181645.1-43s1c1
Sequence:CCGGGAACAAATTGACATCATGGTACTCGAGTACCATGATGTCAATTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167564    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181645.1-226s1c1
Sequence:CCGGGCAATGACTCAGAATTATGAACTCGAGTTCATAATTCTGAGTCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181645.3-1232s21c1
Sequence:CCGGCATCAGAAGGAGATCACTATACTCGAGTATAGTGATCTCCTTCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242982    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181645.3-2272s21c1
Sequence:CCGGGAGAAAGGGAAGTGCTATATTCTCGAGAATATAGCACTTCCCTTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181645.3-1454s21c1
Sequence:CCGGTCAAGGCATACATCTATTAATCTCGAGATTAATAGATGTATGCCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181645.3-1664s21c1
Sequence:CCGGCCCTTGCCACCTTCGACATTTCTCGAGAAATGTCGAAGGTGGCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181645
CCDC67 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 67
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168087    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181645.1-598s1c1
Sequence:CCGGCGTTTGATATGTGACCCAGATCTCGAGATCTGGGTCACATATCAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167871    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181645.1-43s1c1
Sequence:CCGGGAACAAATTGACATCATGGTACTCGAGTACCATGATGTCAATTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167564    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181645.1-226s1c1
Sequence:CCGGGCAATGACTCAGAATTATGAACTCGAGTTCATAATTCTGAGTCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181645.3-1232s21c1
Sequence:CCGGCATCAGAAGGAGATCACTATACTCGAGTATAGTGATCTCCTTCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242982    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181645.3-2272s21c1
Sequence:CCGGGAGAAAGGGAAGTGCTATATTCTCGAGAATATAGCACTTCCCTTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181645.3-1454s21c1
Sequence:CCGGTCAAGGCATACATCTATTAATCTCGAGATTAATAGATGTATGCCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181645.3-1664s21c1
Sequence:CCGGCCCTTGCCACCTTCGACATTTCTCGAGAAATGTCGAAGGTGGCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181645
CCDC67 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 67
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168087    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181645.1-598s1c1
Sequence:CCGGCGTTTGATATGTGACCCAGATCTCGAGATCTGGGTCACATATCAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167871    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181645.1-43s1c1
Sequence:CCGGGAACAAATTGACATCATGGTACTCGAGTACCATGATGTCAATTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167564    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181645.1-226s1c1
Sequence:CCGGGCAATGACTCAGAATTATGAACTCGAGTTCATAATTCTGAGTCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181645.3-1232s21c1
Sequence:CCGGCATCAGAAGGAGATCACTATACTCGAGTATAGTGATCTCCTTCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242982    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181645.3-2272s21c1
Sequence:CCGGGAGAAAGGGAAGTGCTATATTCTCGAGAATATAGCACTTCCCTTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181645.3-1454s21c1
Sequence:CCGGTCAAGGCATACATCTATTAATCTCGAGATTAATAGATGTATGCCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181645.3-1664s21c1
Sequence:CCGGCCCTTGCCACCTTCGACATTTCTCGAGAAATGTCGAAGGTGGCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181816
CCDC67 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 67
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202371    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181816.1-1252s1c1
Sequence:CCGGGAAGGGAATGATGGGCGATTTCTCGAGAAATCGCCCATCATTCCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181816.1-847s1c1
Sequence:CCGGGCATAGAGAACTGCTGAGAATCTCGAGATTCTCAGCAGTTCTCTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181816.1-638s1c1
Sequence:CCGGGAGTTCATTATCGAGAAGTTACTCGAGTAACTTCTCGATAATGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191691    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181816.1-298s1c1
Sequence:CCGGGCTGAGATTACACCAAATGAACTCGAGTTCATTTGGTGTAATCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181816.1-1315s1c1
Sequence:CCGGGCATTCACAGTGCACATCAATCTCGAGATTGATGTGCACTGTGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181816.1-1568s1c1
Sequence:CCGGCCATTGGTTGGTGACAATGAACTCGAGTTCATTGTCACCAACCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215558    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181816.2-2415s1c1
Sequence:CCGGGATAAGCCAATACCCTGAATACTCGAGTATTCAGGGTATTGGCTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215447    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181816.2-391s1c1
Sequence:CCGGGAGAAATGTAATCTAGTAATGCTCGAGCATTACTAGATTACATTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216161    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181816.2-2532s1c1
Sequence:CCGGCCACATATCAGCACCATTTAACTCGAGTTAAATGGTGCTGATATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181816
CCDC67 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 67
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202371    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181816.1-1252s1c1
Sequence:CCGGGAAGGGAATGATGGGCGATTTCTCGAGAAATCGCCCATCATTCCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181816.1-847s1c1
Sequence:CCGGGCATAGAGAACTGCTGAGAATCTCGAGATTCTCAGCAGTTCTCTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181816.1-638s1c1
Sequence:CCGGGAGTTCATTATCGAGAAGTTACTCGAGTAACTTCTCGATAATGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191691    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181816.1-298s1c1
Sequence:CCGGGCTGAGATTACACCAAATGAACTCGAGTTCATTTGGTGTAATCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181816.1-1315s1c1
Sequence:CCGGGCATTCACAGTGCACATCAATCTCGAGATTGATGTGCACTGTGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181816.1-1568s1c1
Sequence:CCGGCCATTGGTTGGTGACAATGAACTCGAGTTCATTGTCACCAACCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215558    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181816.2-2415s1c1
Sequence:CCGGGATAAGCCAATACCCTGAATACTCGAGTATTCAGGGTATTGGCTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215447    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181816.2-391s1c1
Sequence:CCGGGAGAAATGTAATCTAGTAATGCTCGAGCATTACTAGATTACATTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216161    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181816.2-2532s1c1
Sequence:CCGGCCACATATCAGCACCATTTAACTCGAGTTAAATGGTGCTGATATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181816
CCDC67 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 67
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202371    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181816.1-1252s1c1
Sequence:CCGGGAAGGGAATGATGGGCGATTTCTCGAGAAATCGCCCATCATTCCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181816.1-847s1c1
Sequence:CCGGGCATAGAGAACTGCTGAGAATCTCGAGATTCTCAGCAGTTCTCTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181816.1-638s1c1
Sequence:CCGGGAGTTCATTATCGAGAAGTTACTCGAGTAACTTCTCGATAATGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191691    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181816.1-298s1c1
Sequence:CCGGGCTGAGATTACACCAAATGAACTCGAGTTCATTTGGTGTAATCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181816.1-1315s1c1
Sequence:CCGGGCATTCACAGTGCACATCAATCTCGAGATTGATGTGCACTGTGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181816.1-1568s1c1
Sequence:CCGGCCATTGGTTGGTGACAATGAACTCGAGTTCATTGTCACCAACCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215558    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181816.2-2415s1c1
Sequence:CCGGGATAAGCCAATACCCTGAATACTCGAGTATTCAGGGTATTGGCTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215447    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181816.2-391s1c1
Sequence:CCGGGAGAAATGTAATCTAGTAATGCTCGAGCATTACTAGATTACATTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216161    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181816.2-2532s1c1
Sequence:CCGGCCACATATCAGCACCATTTAACTCGAGTTAAATGGTGCTGATATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks