EMAIL THIS PAGE TO A FRIEND

CCDC68

coiled-coil domain containing 68

141 Gene Product Result for
Synonyms: SE57-1
UniProtKB ID: Q9H2F9, B2R9I3
Gene ID:
Mouse(381175) coiled-coil domain containing 68
Rat(291530) coiled-coil domain containing 68
sheep(101120290) coiled-coil domain containing 68
naked mole-rat(101706425) coiled-coil domain containing 68
dog(483973) coiled-coil domain containing 68
cow(504721) coiled-coil domain containing 68
domestic cat(101097104) coiled-coil domain containing 68
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025214 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025214 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025214 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_201362 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_201362 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_201362 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU003731 MISSION® esiRNA esiRNA targeting human CCDC68 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025214 Rosetta Predictions human pricing
NM_001077667 Rosetta Predictions rat pricing
NM_201362 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025214 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00144198 predicted 1095
2 SASI_Hs01_00144199 predicted 340
3 SASI_Hs01_00144200 predicted 1204
4 SASI_Hs01_00144201 predicted 1107
5 SASI_Hs01_00144203 predicted 281
6 SASI_Hs02_00357998 predicted 340
7 SASI_Hs02_00357999 predicted 822
8 SASI_Hs01_00144204 predicted 583
9 SASI_Hs01_00144205 predicted 471
10 SASI_Hs02_00358000 predicted 351
11 SASI_Hs01_00144197 predicted 778
12 SASI_Hs01_00144202 predicted 832
13 SASI_Hs01_00144206 predicted 630
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077667 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00207792 predicted 251
2 SASI_Rn02_00207793 predicted 325
3 SASI_Rn02_00207794 predicted 1066
4 SASI_Rn02_00207795 predicted 484
5 SASI_Rn02_00207796 predicted 443
6 SASI_Rn02_00207797 predicted 1158
7 SASI_Rn02_00207798 predicted 1026
8 SASI_Rn02_00207799 predicted 1146
9 SASI_Rn02_00207800 predicted 1053
10 SASI_Rn02_00207801 predicted 1028
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201362 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00109794 predicted 241
2 SASI_Mm01_00109795 predicted 1032
3 SASI_Mm01_00109796 predicted 703
4 SASI_Mm01_00109798 predicted 515
5 SASI_Mm01_00109799 predicted 457
6 SASI_Mm01_00109801 predicted 399
7 SASI_Mm02_00351518 predicted 1162
8 SASI_Mm01_00109802 predicted 387
9 SASI_Mm01_00109803 predicted 995
10 SASI_Mm02_00351519 predicted 1015
11 SASI_Mm01_00109797 predicted 448
12 SASI_Mm01_00109800 predicted 585
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025214
CCDC68 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 68
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000417878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025214.2-1261s21c1
Sequence:CCGGTGTTGATTAGGTTACGGAAATCTCGAGATTTCCGTAACCTAATCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412383    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025214.2-1313s21c1
Sequence:CCGGGACTGCGTGAGTCTTATTTATCTCGAGATAAATAAGACTCACGCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131031    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025214.1-206s1c1
Sequence:CCGGCCCAAGGGATAAGATGGAAGACTCGAGTCTTCCATCTTATCCCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025214.1-1038s1c1
Sequence:CCGGGAAGCCCAGAATAAAGAACTACTCGAGTAGTTCTTTATTCTGGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025214.1-592s1c1
Sequence:CCGGCGCAATCTGAAGAAGTGAGAACTCGAGTTCTCACTTCTTCAGATTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025214.1-207s1c1
Sequence:CCGGCCAAGGGATAAGATGGAAGATCTCGAGATCTTCCATCTTATCCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128803    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025214.1-1916s1c1
Sequence:CCGGCCTCTGCCTTTGTGACTAATTCTCGAGAATTAGTCACAAAGGCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129087    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025214.1-2062s1c1
Sequence:CCGGGCAGCCAGAAAGAATCTGAATCTCGAGATTCAGATTCTTTCTGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130234    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025214.1-1078s1c1
Sequence:CCGGCATCTGAAACTCCTAGGACAACTCGAGTTGTCCTAGGAGTTTCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025214
CCDC68 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 68
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000417878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025214.2-1261s21c1
Sequence:CCGGTGTTGATTAGGTTACGGAAATCTCGAGATTTCCGTAACCTAATCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412383    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025214.2-1313s21c1
Sequence:CCGGGACTGCGTGAGTCTTATTTATCTCGAGATAAATAAGACTCACGCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131031    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025214.1-206s1c1
Sequence:CCGGCCCAAGGGATAAGATGGAAGACTCGAGTCTTCCATCTTATCCCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025214.1-1038s1c1
Sequence:CCGGGAAGCCCAGAATAAAGAACTACTCGAGTAGTTCTTTATTCTGGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025214.1-592s1c1
Sequence:CCGGCGCAATCTGAAGAAGTGAGAACTCGAGTTCTCACTTCTTCAGATTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025214.1-207s1c1
Sequence:CCGGCCAAGGGATAAGATGGAAGATCTCGAGATCTTCCATCTTATCCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128803    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025214.1-1916s1c1
Sequence:CCGGCCTCTGCCTTTGTGACTAATTCTCGAGAATTAGTCACAAAGGCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129087    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025214.1-2062s1c1
Sequence:CCGGGCAGCCAGAAAGAATCTGAATCTCGAGATTCAGATTCTTTCTGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130234    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025214.1-1078s1c1
Sequence:CCGGCATCTGAAACTCCTAGGACAACTCGAGTTGTCCTAGGAGTTTCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025214
CCDC68 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 68
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000417878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025214.2-1261s21c1
Sequence:CCGGTGTTGATTAGGTTACGGAAATCTCGAGATTTCCGTAACCTAATCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412383    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025214.2-1313s21c1
Sequence:CCGGGACTGCGTGAGTCTTATTTATCTCGAGATAAATAAGACTCACGCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131031    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025214.1-206s1c1
Sequence:CCGGCCCAAGGGATAAGATGGAAGACTCGAGTCTTCCATCTTATCCCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025214.1-1038s1c1
Sequence:CCGGGAAGCCCAGAATAAAGAACTACTCGAGTAGTTCTTTATTCTGGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025214.1-592s1c1
Sequence:CCGGCGCAATCTGAAGAAGTGAGAACTCGAGTTCTCACTTCTTCAGATTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025214.1-207s1c1
Sequence:CCGGCCAAGGGATAAGATGGAAGATCTCGAGATCTTCCATCTTATCCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128803    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025214.1-1916s1c1
Sequence:CCGGCCTCTGCCTTTGTGACTAATTCTCGAGAATTAGTCACAAAGGCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129087    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025214.1-2062s1c1
Sequence:CCGGGCAGCCAGAAAGAATCTGAATCTCGAGATTCAGATTCTTTCTGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130234    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025214.1-1078s1c1
Sequence:CCGGCATCTGAAACTCCTAGGACAACTCGAGTTGTCCTAGGAGTTTCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_201362
CCDC68 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 68
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000216911    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201362.2-1032s1c1
Sequence:CCGGGAAGGTGCTTCTCCATATTTGCTCGAGCAAATATGGAGAAGCACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201341    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201362.1-724s1c1
Sequence:CCGGGCTTAAATCCAACGCTGCAAACTCGAGTTTGCAGCGTTGGATTTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201209    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201362.1-581s1c1
Sequence:CCGGGCCGAAAGTCTGAATCTACTTCTCGAGAAGTAGATTCAGACTTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201362.1-757s1c1
Sequence:CCGGCCAGGATCTTCAAACGGAGATCTCGAGATCTCCGTTTGAAGATCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201362.1-550s1c1
Sequence:CCGGCCTTGAGAAAGAGCAGGCATTCTCGAGAATGCCTGCTCTTTCTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201362.1-700s1c1
Sequence:CCGGGCGTTTAGAAAGCAAACTGTTCTCGAGAACAGTTTGCTTTCTAAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192868    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201362.1-1093s1c1
Sequence:CCGGGCTCTGATAGAGAAGGACTTACTCGAGTAAGTCCTTCTCTATCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192985    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201362.1-1149s1c1
Sequence:CCGGGCTCCAGAGTTGAAATGACATCTCGAGATGTCATTTCAACTCTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_201362
CCDC68 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 68
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000216911    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201362.2-1032s1c1
Sequence:CCGGGAAGGTGCTTCTCCATATTTGCTCGAGCAAATATGGAGAAGCACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201341    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201362.1-724s1c1
Sequence:CCGGGCTTAAATCCAACGCTGCAAACTCGAGTTTGCAGCGTTGGATTTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201209    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201362.1-581s1c1
Sequence:CCGGGCCGAAAGTCTGAATCTACTTCTCGAGAAGTAGATTCAGACTTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201362.1-757s1c1
Sequence:CCGGCCAGGATCTTCAAACGGAGATCTCGAGATCTCCGTTTGAAGATCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201362.1-550s1c1
Sequence:CCGGCCTTGAGAAAGAGCAGGCATTCTCGAGAATGCCTGCTCTTTCTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201362.1-700s1c1
Sequence:CCGGGCGTTTAGAAAGCAAACTGTTCTCGAGAACAGTTTGCTTTCTAAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192868    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201362.1-1093s1c1
Sequence:CCGGGCTCTGATAGAGAAGGACTTACTCGAGTAAGTCCTTCTCTATCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192985    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201362.1-1149s1c1
Sequence:CCGGGCTCCAGAGTTGAAATGACATCTCGAGATGTCATTTCAACTCTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_201362
CCDC68 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 68
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000216911    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201362.2-1032s1c1
Sequence:CCGGGAAGGTGCTTCTCCATATTTGCTCGAGCAAATATGGAGAAGCACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201341    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201362.1-724s1c1
Sequence:CCGGGCTTAAATCCAACGCTGCAAACTCGAGTTTGCAGCGTTGGATTTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201209    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201362.1-581s1c1
Sequence:CCGGGCCGAAAGTCTGAATCTACTTCTCGAGAAGTAGATTCAGACTTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201362.1-757s1c1
Sequence:CCGGCCAGGATCTTCAAACGGAGATCTCGAGATCTCCGTTTGAAGATCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201362.1-550s1c1
Sequence:CCGGCCTTGAGAAAGAGCAGGCATTCTCGAGAATGCCTGCTCTTTCTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201362.1-700s1c1
Sequence:CCGGGCGTTTAGAAAGCAAACTGTTCTCGAGAACAGTTTGCTTTCTAAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192868    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201362.1-1093s1c1
Sequence:CCGGGCTCTGATAGAGAAGGACTTACTCGAGTAAGTCCTTCTCTATCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192985    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201362.1-1149s1c1
Sequence:CCGGGCTCCAGAGTTGAAATGACATCTCGAGATGTCATTTCAACTCTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks