EMAIL THIS PAGE TO A FRIEND

CCDC69

coiled-coil domain containing 69

74 Gene Product Result for
UniProtKB ID: A6NI79, A8K9X6
Gene ID:
Mouse(52570) coiled-coil domain containing 69
Rat(497906) coiled-coil domain containing 69
Zebrafish(794166) coiled-coil domain containing 69
chicken(416268) coiled-coil domain containing 69
cow(529878) coiled-coil domain containing 69
domestic cat(101084683) coiled-coil domain containing 69
dog(489176) coiled-coil domain containing 69
naked mole-rat(101705211) coiled-coil domain containing 69
sheep(101111284) coiled-coil domain containing 69
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177471 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177471 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177471 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015621 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015621 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015621 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU124591 MISSION® esiRNA esiRNA human CCDC69 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015621 Rosetta Predictions human pricing
NM_001109031 Rosetta Predictions rat pricing
NM_177471 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015621 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00176050 predicted 663
2 SASI_Hs01_00176051 predicted 399
3 SASI_Hs02_00348213 predicted 477
4 SASI_Hs01_00176052 predicted 382
5 SASI_Hs01_00176053 predicted 363
6 SASI_Hs01_00176054 predicted 495
7 SASI_Hs01_00176056 predicted 660
8 SASI_Hs01_00176057 predicted 677
9 SASI_Hs02_00348214 predicted 676
10 SASI_Hs01_00176058 predicted 511
11 SASI_Hs01_00176055 predicted 448
12 SASI_Hs01_00176059 predicted 440
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109031 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00244494 predicted 1085
2 SASI_Rn02_00244495 predicted 420
3 SASI_Rn02_00244496 predicted 283
4 SASI_Rn02_00244497 predicted 224
5 SASI_Rn02_00244498 predicted 1088
6 SASI_Rn02_00244499 predicted 610
7 SASI_Rn02_00244500 predicted 1111
8 SASI_Rn02_00244501 predicted 435
9 SASI_Rn02_00244502 predicted 337
10 SASI_Rn02_00244503 predicted 567
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177471 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00347682 predicted 926
2 SASI_Mm02_00347683 predicted 226
3 SASI_Mm02_00347684 predicted 608
4 SASI_Mm02_00347685 predicted 960
5 SASI_Mm01_00097696 predicted 418
6 SASI_Mm02_00347686 predicted 708
7 SASI_Mm01_00097698 predicted 450
8 SASI_Mm01_00097699 predicted 279
9 SASI_Mm02_00347687 predicted 1114
10 SASI_Mm02_00347688 predicted 218
11 SASI_Mm01_00097692 predicted 769
12 SASI_Mm01_00097693 predicted 943
13 SASI_Mm01_00097694 predicted 529
14 SASI_Mm01_00097695 predicted 780
15 SASI_Mm01_00097697 predicted 537
16 SASI_Mm01_00097700 predicted 808
17 SASI_Mm01_00097701 predicted 296
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177471
CCDC69 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 69
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000184122    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177471.2-347s1c1
Sequence:CCGGCCATCCTTAGCCGACTCTATACTCGAGTATAGAGTCGGCTAAGGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179325    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177471.2-553s1c1
Sequence:CCGGGTTGAGGACCTACAATTCCAACTCGAGTTGGAATTGTAGGTCCTCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177471.4-346s21c1
Sequence:CCGGCCATCCTTAGCCGACTCTATACTCGAGTATAGAGTCGGCTAAGGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216593    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177471.4-420s1c1
Sequence:CCGGGAGAGTTTACACCATGTTATTCTCGAGAATAACATGGTGTAAACTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217494    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177471.4-964s1c1
Sequence:CCGGGAACAAGCAGGCAGTTATATTCTCGAGAATATAACTGCCTGCTTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177471.4-420s21c1
Sequence:CCGGGAGAGTTTACACCATGTTATTCTCGAGAATAACATGGTGTAAACTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177471.4-548s21c1
Sequence:CCGGGGAGGTTGAGGACCTACAATTCTCGAGAATTGTAGGTCCTCAACCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248941    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177471.4-964s21c1
Sequence:CCGGGAACAAGCAGGCAGTTATATTCTCGAGAATATAACTGCCTGCTTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177471.4-484s21c1
Sequence:CCGGTCCTCCTGGAGATGCTGAAAGCTCGAGCTTTCAGCATCTCCAGGAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177471
CCDC69 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 69
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000184122    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177471.2-347s1c1
Sequence:CCGGCCATCCTTAGCCGACTCTATACTCGAGTATAGAGTCGGCTAAGGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179325    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177471.2-553s1c1
Sequence:CCGGGTTGAGGACCTACAATTCCAACTCGAGTTGGAATTGTAGGTCCTCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177471.4-346s21c1
Sequence:CCGGCCATCCTTAGCCGACTCTATACTCGAGTATAGAGTCGGCTAAGGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216593    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177471.4-420s1c1
Sequence:CCGGGAGAGTTTACACCATGTTATTCTCGAGAATAACATGGTGTAAACTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217494    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177471.4-964s1c1
Sequence:CCGGGAACAAGCAGGCAGTTATATTCTCGAGAATATAACTGCCTGCTTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177471.4-420s21c1
Sequence:CCGGGAGAGTTTACACCATGTTATTCTCGAGAATAACATGGTGTAAACTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177471.4-548s21c1
Sequence:CCGGGGAGGTTGAGGACCTACAATTCTCGAGAATTGTAGGTCCTCAACCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248941    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177471.4-964s21c1
Sequence:CCGGGAACAAGCAGGCAGTTATATTCTCGAGAATATAACTGCCTGCTTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177471.4-484s21c1
Sequence:CCGGTCCTCCTGGAGATGCTGAAAGCTCGAGCTTTCAGCATCTCCAGGAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177471
CCDC69 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 69
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000184122    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177471.2-347s1c1
Sequence:CCGGCCATCCTTAGCCGACTCTATACTCGAGTATAGAGTCGGCTAAGGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179325    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177471.2-553s1c1
Sequence:CCGGGTTGAGGACCTACAATTCCAACTCGAGTTGGAATTGTAGGTCCTCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177471.4-346s21c1
Sequence:CCGGCCATCCTTAGCCGACTCTATACTCGAGTATAGAGTCGGCTAAGGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216593    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177471.4-420s1c1
Sequence:CCGGGAGAGTTTACACCATGTTATTCTCGAGAATAACATGGTGTAAACTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217494    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177471.4-964s1c1
Sequence:CCGGGAACAAGCAGGCAGTTATATTCTCGAGAATATAACTGCCTGCTTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177471.4-420s21c1
Sequence:CCGGGAGAGTTTACACCATGTTATTCTCGAGAATAACATGGTGTAAACTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177471.4-548s21c1
Sequence:CCGGGGAGGTTGAGGACCTACAATTCTCGAGAATTGTAGGTCCTCAACCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248941    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177471.4-964s21c1
Sequence:CCGGGAACAAGCAGGCAGTTATATTCTCGAGAATATAACTGCCTGCTTGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177471.4-484s21c1
Sequence:CCGGTCCTCCTGGAGATGCTGAAAGCTCGAGCTTTCAGCATCTCCAGGAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015621
CCDC69 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 69
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008689    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015621.2-1388s1c1
Sequence:CCGGGCCGACTTGCTGACTTATCAACTCGAGTTGATAAGTCAGCAAGTCGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015621.2-292s1c1
Sequence:CCGGCAGAAGGATATAACCAGAATTCTCGAGAATTCTGGTTATATCCTTCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015621.2-678s1c1
Sequence:CCGGCGAGATGAAGAATGAGCGTATCTCGAGATACGCTCATTCTTCATCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015621.2-593s1c1
Sequence:CCGGGCCGAAACTATAAGAAACATACTCGAGTATGTTTCTTATAGTTTCGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015621.2-451s1c1
Sequence:CCGGGCCTCATATGAACAGGAGAAACTCGAGTTTCTCCTGTTCATATGAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427436    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015621.2-1330s21c1
Sequence:CCGGCACGCTGGCCATTTGACATAACTCGAGTTATGTCAAATGGCCAGCGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421125    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015621.2-1483s21c1
Sequence:CCGGGACTGGTCAAAGGACTCTTATCTCGAGATAAGAGTCCTTTGACCAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015621.2-994s21c1
Sequence:CCGGGTCTCTTTCCTCGCCACATAGCTCGAGCTATGTGGCGAGGAAAGAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015621
CCDC69 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 69
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008689    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015621.2-1388s1c1
Sequence:CCGGGCCGACTTGCTGACTTATCAACTCGAGTTGATAAGTCAGCAAGTCGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015621.2-292s1c1
Sequence:CCGGCAGAAGGATATAACCAGAATTCTCGAGAATTCTGGTTATATCCTTCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015621.2-678s1c1
Sequence:CCGGCGAGATGAAGAATGAGCGTATCTCGAGATACGCTCATTCTTCATCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015621.2-593s1c1
Sequence:CCGGGCCGAAACTATAAGAAACATACTCGAGTATGTTTCTTATAGTTTCGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015621.2-451s1c1
Sequence:CCGGGCCTCATATGAACAGGAGAAACTCGAGTTTCTCCTGTTCATATGAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427436    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015621.2-1330s21c1
Sequence:CCGGCACGCTGGCCATTTGACATAACTCGAGTTATGTCAAATGGCCAGCGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421125    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015621.2-1483s21c1
Sequence:CCGGGACTGGTCAAAGGACTCTTATCTCGAGATAAGAGTCCTTTGACCAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015621.2-994s21c1
Sequence:CCGGGTCTCTTTCCTCGCCACATAGCTCGAGCTATGTGGCGAGGAAAGAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015621
CCDC69 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 69
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008689    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015621.2-1388s1c1
Sequence:CCGGGCCGACTTGCTGACTTATCAACTCGAGTTGATAAGTCAGCAAGTCGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015621.2-292s1c1
Sequence:CCGGCAGAAGGATATAACCAGAATTCTCGAGAATTCTGGTTATATCCTTCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015621.2-678s1c1
Sequence:CCGGCGAGATGAAGAATGAGCGTATCTCGAGATACGCTCATTCTTCATCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015621.2-593s1c1
Sequence:CCGGGCCGAAACTATAAGAAACATACTCGAGTATGTTTCTTATAGTTTCGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015621.2-451s1c1
Sequence:CCGGGCCTCATATGAACAGGAGAAACTCGAGTTTCTCCTGTTCATATGAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427436    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015621.2-1330s21c1
Sequence:CCGGCACGCTGGCCATTTGACATAACTCGAGTTATGTCAAATGGCCAGCGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421125    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015621.2-1483s21c1
Sequence:CCGGGACTGGTCAAAGGACTCTTATCTCGAGATAAGAGTCCTTTGACCAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015621.2-994s21c1
Sequence:CCGGGTCTCTTTCCTCGCCACATAGCTCGAGCTATGTGGCGAGGAAAGAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)