EMAIL THIS PAGE TO A FRIEND

CCDC6

coiled-coil domain containing 6

339 Gene Product Result for
Synonyms: D10S170 H4 PTC TPC TST1
UniProtKB ID: Q16204, Q15250, Q6GSG7
Gene ID:
Human(8030) Summary: This gene encodes a coiled-coil domain-containing protein. The encoded protein is ubiquitously expressed and may function as a tumor suppressor. A chromosomal rearrangement resulting in the expression of a fusion gene containing a portion of this gene and the intracellular kinase-encoding domain of the ret proto-oncogene is the cause of thyroid papillary carcinoma.[provided by RefSeq, Sep 2010]
Mouse(76551) coiled-coil domain containing 6
Rat(691155) coiled-coil domain containing 6
sheep(101120801) coiled-coil domain containing 6
domestic guinea pig(100733712) coiled-coil domain containing 6
naked mole-rat(101721767) coiled-coil domain containing 6
chicken(423666) coiled-coil domain containing 6
Horse(100062742) coiled-coil domain containing 6
cow(522998) coiled-coil domain containing 6
domestic cat(101100594) coiled-coil domain containing 6
dog(488993) coiled-coil domain containing 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005436 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005436 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005436 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001111121 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001111121 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001111121 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005436 Rosetta Predictions human pricing
XM_001077030 Rosetta Predictions rat pricing
NM_001111121 Rosetta Predictions mouse pricing
XM_618775 Rosetta Predictions mouse pricing
XM_897673 Rosetta Predictions mouse pricing
XM_897687 Rosetta Predictions mouse pricing
XM_908442 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005436 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00064930 predicted 1383
2 SASI_Hs01_00064932 predicted 1750
3 SASI_Hs01_00064933 predicted 1366
4 SASI_Hs01_00064934 predicted 1727
5 SASI_Hs01_00064935 predicted 1101
6 SASI_Hs01_00064936 predicted 1469
7 SASI_Hs01_00064937 predicted 2066
8 SASI_Hs01_00064938 predicted 2139
9 SASI_Hs01_00064939 predicted 1040
10 SASI_Hs02_00339589 predicted 1267
11 SASI_Hs01_00064931 predicted 622
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077030 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00355489 predicted 1083
2 SASI_Rn02_00355490 predicted 743
3 SASI_Rn02_00355491 predicted 753
4 SASI_Rn02_00355492 predicted 475
5 SASI_Rn02_00355493 predicted 807
6 SASI_Rn02_00355494 predicted 355
7 SASI_Rn02_00355495 predicted 1051
8 SASI_Rn02_00355496 predicted 1141
9 SASI_Rn02_00355497 predicted 965
10 SASI_Rn02_00355498 predicted 985
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111121 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00306492 predicted 1042
2 SASI_Mm02_00306493 predicted 538
3 SASI_Mm02_00306494 predicted 1586
4 SASI_Mm02_00306495 predicted 986
5 SASI_Mm02_00306496 predicted 580
6 SASI_Mm02_00306497 predicted 1611
7 SASI_Mm02_00306498 predicted 661
8 SASI_Mm02_00306499 predicted 886
9 SASI_Mm02_00306500 predicted 1223
10 SASI_Mm02_00306501 predicted 1578
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_618775 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00223688 predicted 1265
2 SASI_Mm01_00223689 predicted 1056
3 SASI_Mm01_00223690 predicted 538
4 SASI_Mm01_00223691 predicted 1588
5 SASI_Mm01_00223692 predicted 993
6 SASI_Mm01_00223693 predicted 587
7 SASI_Mm01_00223694 predicted 1610
8 SASI_Mm01_00223695 predicted 665
9 SASI_Mm01_00223696 predicted 893
10 SASI_Mm01_00223697 predicted 1585
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897673 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00205052 predicted 1053
2 SASI_Mm01_00205053 predicted 1268
3 SASI_Mm01_00205054 predicted 1420
4 SASI_Mm01_00205055 predicted 1393
5 SASI_Mm01_00205056 predicted 538
6 SASI_Mm01_00205057 predicted 1408
7 SASI_Mm01_00205058 predicted 999
8 SASI_Mm01_00205059 predicted 587
9 SASI_Mm01_00205060 predicted 893
10 SASI_Mm01_00205061 predicted 891
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897687 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00282787 predicted 1261
2 SASI_Mm01_00282788 predicted 1047
3 SASI_Mm01_00282789 predicted 1524
4 SASI_Mm01_00282790 predicted 544
5 SASI_Mm01_00282791 predicted 1520
6 SASI_Mm01_00282792 predicted 992
7 SASI_Mm01_00282793 predicted 578
8 SASI_Mm01_00282794 predicted 665
9 SASI_Mm01_00282795 predicted 894
10 SASI_Mm01_00282796 predicted 894
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_908442 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00434096 predicted 865
2 SASI_Mm02_00434097 predicted 358
3 SASI_Mm02_00434098 predicted 1411
4 SASI_Mm02_00434099 predicted 807
5 SASI_Mm02_00434100 predicted 395
6 SASI_Mm02_00434101 predicted 1425
7 SASI_Mm02_00434102 predicted 487
8 SASI_Mm02_00434103 predicted 710
9 SASI_Mm02_00434104 predicted 1049
10 SASI_Mm02_00434105 predicted 1400
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005436
VALIDATED
CCDC6 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 6
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307673    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005436.3-2318s21c1
Sequence:CCGGCGCTGTTTGGTATTTGGTATTCTCGAGAATACCAAATACCAAACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_005436.3-1619s21c1
Sequence:CCGGGCTTAGAAATGGACGACGAAACTCGAGTTTCGTCGTCCATTTCTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005436.3-1716s21c1
Sequence:CCGGGAGTTCAAGCAGGCCTATATCCTCGAGGATATAGGCCTGCTTGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005436.3-1134s21c1
Sequence:CCGGGCAGGAATTTCAGGTCAACAACTCGAGTTGTTGACCTGAAATTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_005436.3-2016s21c1
Sequence:CCGGGCCTACTCCTTCGCAACATTCCTCGAGGAATGTTGCGAAGGAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005436.1-237s1c1
Sequence:CCGGGCAAGAGAACAAGGTGCTGAACTCGAGTTCAGCACCTTGTTCTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005436.1-600s1c1
Sequence:CCGGGCAACTTACATTAGAACAGTTCTCGAGAACTGTTCTAATGTAAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_005436.1-534s1c1
Sequence:CCGGGCAGGAATTTCAGGTCAACAACTCGAGTTGTTGACCTGAAATTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_005436.1-1019s1c1
Sequence:CCGGGCTTAGAAATGGACGACGAAACTCGAGTTTCGTCGTCCATTTCTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005436.1-1718s1c1
Sequence:CCGGCGCTGTTTGGTATTTGGTATTCTCGAGAATACCAAATACCAAACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005436
VALIDATED
CCDC6 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 6
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000307673    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005436.3-2318s21c1
Sequence:CCGGCGCTGTTTGGTATTTGGTATTCTCGAGAATACCAAATACCAAACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_005436.3-1619s21c1
Sequence:CCGGGCTTAGAAATGGACGACGAAACTCGAGTTTCGTCGTCCATTTCTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005436.3-1716s21c1
Sequence:CCGGGAGTTCAAGCAGGCCTATATCCTCGAGGATATAGGCCTGCTTGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005436.3-1134s21c1
Sequence:CCGGGCAGGAATTTCAGGTCAACAACTCGAGTTGTTGACCTGAAATTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_005436.3-2016s21c1
Sequence:CCGGGCCTACTCCTTCGCAACATTCCTCGAGGAATGTTGCGAAGGAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005436.1-237s1c1
Sequence:CCGGGCAAGAGAACAAGGTGCTGAACTCGAGTTCAGCACCTTGTTCTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005436.1-600s1c1
Sequence:CCGGGCAACTTACATTAGAACAGTTCTCGAGAACTGTTCTAATGTAAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_005436.1-534s1c1
Sequence:CCGGGCAGGAATTTCAGGTCAACAACTCGAGTTGTTGACCTGAAATTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_005436.1-1019s1c1
Sequence:CCGGGCTTAGAAATGGACGACGAAACTCGAGTTTCGTCGTCCATTTCTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005436.1-1718s1c1
Sequence:CCGGCGCTGTTTGGTATTTGGTATTCTCGAGAATACCAAATACCAAACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005436
VALIDATED
CCDC6 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 6
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000307673    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005436.3-2318s21c1
Sequence:CCGGCGCTGTTTGGTATTTGGTATTCTCGAGAATACCAAATACCAAACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_005436.3-1619s21c1
Sequence:CCGGGCTTAGAAATGGACGACGAAACTCGAGTTTCGTCGTCCATTTCTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005436.3-1716s21c1
Sequence:CCGGGAGTTCAAGCAGGCCTATATCCTCGAGGATATAGGCCTGCTTGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005436.3-1134s21c1
Sequence:CCGGGCAGGAATTTCAGGTCAACAACTCGAGTTGTTGACCTGAAATTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_005436.3-2016s21c1
Sequence:CCGGGCCTACTCCTTCGCAACATTCCTCGAGGAATGTTGCGAAGGAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005436.1-237s1c1
Sequence:CCGGGCAAGAGAACAAGGTGCTGAACTCGAGTTCAGCACCTTGTTCTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005436.1-600s1c1
Sequence:CCGGGCAACTTACATTAGAACAGTTCTCGAGAACTGTTCTAATGTAAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_005436.1-534s1c1
Sequence:CCGGGCAGGAATTTCAGGTCAACAACTCGAGTTGTTGACCTGAAATTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_005436.1-1019s1c1
Sequence:CCGGGCTTAGAAATGGACGACGAAACTCGAGTTTCGTCGTCCATTTCTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005436.1-1718s1c1
Sequence:CCGGCGCTGTTTGGTATTTGGTATTCTCGAGAATACCAAATACCAAACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001111121
VALIDATED
CCDC6 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 6
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000282107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001111121.1-1410s21c1
Sequence:CCGGAGCAGCCCTGACAAGTTTAAACTCGAGTTTAAACTTGTCAGGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001111121.1-1238s21c1
Sequence:CCGGCAGCTCAAGCAGACCTATATCCTCGAGGATATAGGTCTGCTTGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001111121.1-382s21c1
Sequence:CCGGTAGAGCTGGAGACCTACAAACCTCGAGGTTTGTAGGTCTCCAGCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262119    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001111121.1-2289s21c1
Sequence:CCGGACGGGAACTATTGCCTATTAACTCGAGTTAATAGGCAATAGTTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001111121
VALIDATED
CCDC6 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 6
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000282107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001111121.1-1410s21c1
Sequence:CCGGAGCAGCCCTGACAAGTTTAAACTCGAGTTTAAACTTGTCAGGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001111121.1-1238s21c1
Sequence:CCGGCAGCTCAAGCAGACCTATATCCTCGAGGATATAGGTCTGCTTGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001111121.1-382s21c1
Sequence:CCGGTAGAGCTGGAGACCTACAAACCTCGAGGTTTGTAGGTCTCCAGCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262119    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001111121.1-2289s21c1
Sequence:CCGGACGGGAACTATTGCCTATTAACTCGAGTTAATAGGCAATAGTTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001111121
VALIDATED
CCDC6 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 6
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000282107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001111121.1-1410s21c1
Sequence:CCGGAGCAGCCCTGACAAGTTTAAACTCGAGTTTAAACTTGTCAGGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001111121.1-1238s21c1
Sequence:CCGGCAGCTCAAGCAGACCTATATCCTCGAGGATATAGGTCTGCTTGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001111121.1-382s21c1
Sequence:CCGGTAGAGCTGGAGACCTACAAACCTCGAGGTTTGTAGGTCTCCAGCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262119    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001111121.1-2289s21c1
Sequence:CCGGACGGGAACTATTGCCTATTAACTCGAGTTAATAGGCAATAGTTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks