EMAIL THIS PAGE TO A FRIEND

CCDC70

coiled-coil domain containing 70

35 Gene Product Result for
UniProtKB ID: Q6NSX1, Q8N7A8, Q9H097
Gene ID:
Mouse(67929) coiled-coil domain containing 70
naked mole-rat(101725882) coiled-coil domain containing 70
domestic guinea pig(100723679) coiled-coil domain containing 70
sheep(101120419) coiled-coil domain containing 70
dog(606836) coiled-coil domain containing 70
cow(515635) coiled-coil domain containing 70
domestic cat(101092228) coiled-coil domain containing 70
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026459 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026459 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026459 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_031290 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031290 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031290 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031290 Rosetta Predictions human pricing
NM_026459 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031290 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00053008 predicted 702
2 SASI_Hs01_00053009 predicted 665
3 SASI_Hs02_00358722 predicted 903
4 SASI_Hs01_00053010 predicted 504
5 SASI_Hs01_00053011 predicted 309
6 SASI_Hs01_00053012 predicted 485
7 SASI_Hs01_00053013 predicted 715
8 SASI_Hs01_00053014 predicted 683
9 SASI_Hs01_00053015 predicted 491
10 SASI_Hs01_00053016 predicted 696
11 SASI_Hs01_00053017 predicted 281
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026459 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00120703 predicted 582
2 SASI_Mm02_00330317 predicted 271
3 SASI_Mm01_00120705 predicted 609
4 SASI_Mm01_00120706 predicted 769
5 SASI_Mm02_00330318 predicted 463
6 SASI_Mm01_00120707 predicted 377
7 SASI_Mm01_00120708 predicted 279
8 SASI_Mm01_00120709 predicted 822
9 SASI_Mm01_00120710 predicted 389
10 SASI_Mm01_00120711 predicted 588
11 SASI_Mm01_00120704 predicted 521
12 SASI_Mm01_00120712 predicted 700
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026459
CCDC70 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 70
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000184751    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026459.2-361s1c1
Sequence:CCGGCGAAGACTTCAGGGAAGAGATCTCGAGATCTCTTCCCTGAAGTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184678    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026459.2-885s1c1
Sequence:CCGGCAACTGAACACAGAGGGTGATCTCGAGATCACCCTCTGTGTTCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026459.3-601s21c1
Sequence:CCGGATGGGAAAGAGACCGGAATCTCTCGAGAGATTCCGGTCTCTTTCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250215    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026459.3-909s21c1
Sequence:CCGGGTGCAGACATCACTGGTTGGACTCGAGTCCAACCAGTGATGTCTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026459.3-822s21c1
Sequence:CCGGGTCCCTACAATGCCAATGAAGCTCGAGCTTCATTGGCATTGTAGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026459.3-576s21c1
Sequence:CCGGCATTCTGGAGAGAGGATAATGCTCGAGCATTATCCTCTCTCCAGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026459
CCDC70 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 70
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000184751    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026459.2-361s1c1
Sequence:CCGGCGAAGACTTCAGGGAAGAGATCTCGAGATCTCTTCCCTGAAGTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184678    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026459.2-885s1c1
Sequence:CCGGCAACTGAACACAGAGGGTGATCTCGAGATCACCCTCTGTGTTCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026459.3-601s21c1
Sequence:CCGGATGGGAAAGAGACCGGAATCTCTCGAGAGATTCCGGTCTCTTTCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250215    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026459.3-909s21c1
Sequence:CCGGGTGCAGACATCACTGGTTGGACTCGAGTCCAACCAGTGATGTCTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026459.3-822s21c1
Sequence:CCGGGTCCCTACAATGCCAATGAAGCTCGAGCTTCATTGGCATTGTAGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026459.3-576s21c1
Sequence:CCGGCATTCTGGAGAGAGGATAATGCTCGAGCATTATCCTCTCTCCAGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026459
CCDC70 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 70
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000184751    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026459.2-361s1c1
Sequence:CCGGCGAAGACTTCAGGGAAGAGATCTCGAGATCTCTTCCCTGAAGTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184678    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026459.2-885s1c1
Sequence:CCGGCAACTGAACACAGAGGGTGATCTCGAGATCACCCTCTGTGTTCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026459.3-601s21c1
Sequence:CCGGATGGGAAAGAGACCGGAATCTCTCGAGAGATTCCGGTCTCTTTCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250215    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026459.3-909s21c1
Sequence:CCGGGTGCAGACATCACTGGTTGGACTCGAGTCCAACCAGTGATGTCTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026459.3-822s21c1
Sequence:CCGGGTCCCTACAATGCCAATGAAGCTCGAGCTTCATTGGCATTGTAGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026459.3-576s21c1
Sequence:CCGGCATTCTGGAGAGAGGATAATGCTCGAGCATTATCCTCTCTCCAGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031290
CCDC70 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 70
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172763    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031290.1-541s1c1
Sequence:CCGGCCTTTCTGGGAAGAGGAGAAACTCGAGTTTCTCCTCTTCCCAGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172733    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031290.1-679s1c1
Sequence:CCGGGAGGACAATGCCTTATGGGAACTCGAGTTCCCATAAGGCATTGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172641    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031290.1-708s1c1
Sequence:CCGGGAACCTTCTTCAGGAGGACAACTCGAGTTGTCCTCCTGAAGAAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168424    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031290.1-384s1c1
Sequence:CCGGGAAACTAATGCACAAGCTGCACTCGAGTGCAGCTTGTGCATTAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168103    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031290.1-684s1c1
Sequence:CCGGCAATGCCTTATGGGAAAGAGACTCGAGTCTCTTTCCCATAAGGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031290.2-674s21c1
Sequence:CCGGCACTTTCTGGAAGGAGGATAACTCGAGTTATCCTCCTTCCAGAAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031290.2-818s21c1
Sequence:CCGGGAAAGCCCTGTGGGAAGATAACTCGAGTTATCTTCCCACAGGGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031290
CCDC70 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 70
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172763    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031290.1-541s1c1
Sequence:CCGGCCTTTCTGGGAAGAGGAGAAACTCGAGTTTCTCCTCTTCCCAGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172733    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031290.1-679s1c1
Sequence:CCGGGAGGACAATGCCTTATGGGAACTCGAGTTCCCATAAGGCATTGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172641    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031290.1-708s1c1
Sequence:CCGGGAACCTTCTTCAGGAGGACAACTCGAGTTGTCCTCCTGAAGAAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168424    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031290.1-384s1c1
Sequence:CCGGGAAACTAATGCACAAGCTGCACTCGAGTGCAGCTTGTGCATTAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168103    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031290.1-684s1c1
Sequence:CCGGCAATGCCTTATGGGAAAGAGACTCGAGTCTCTTTCCCATAAGGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031290.2-674s21c1
Sequence:CCGGCACTTTCTGGAAGGAGGATAACTCGAGTTATCCTCCTTCCAGAAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031290.2-818s21c1
Sequence:CCGGGAAAGCCCTGTGGGAAGATAACTCGAGTTATCTTCCCACAGGGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031290
CCDC70 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 70
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172763    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031290.1-541s1c1
Sequence:CCGGCCTTTCTGGGAAGAGGAGAAACTCGAGTTTCTCCTCTTCCCAGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172733    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031290.1-679s1c1
Sequence:CCGGGAGGACAATGCCTTATGGGAACTCGAGTTCCCATAAGGCATTGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172641    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031290.1-708s1c1
Sequence:CCGGGAACCTTCTTCAGGAGGACAACTCGAGTTGTCCTCCTGAAGAAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168424    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031290.1-384s1c1
Sequence:CCGGGAAACTAATGCACAAGCTGCACTCGAGTGCAGCTTGTGCATTAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168103    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031290.1-684s1c1
Sequence:CCGGCAATGCCTTATGGGAAAGAGACTCGAGTCTCTTTCCCATAAGGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031290.2-674s21c1
Sequence:CCGGCACTTTCTGGAAGGAGGATAACTCGAGTTATCCTCCTTCCAGAAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031290.2-818s21c1
Sequence:CCGGGAAAGCCCTGTGGGAAGATAACTCGAGTTATCTTCCCACAGGGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks