EMAIL THIS PAGE TO A FRIEND

CCDC71

coiled-coil domain containing 71

82 Gene Product Result for
UniProtKB ID: Q8IV32, Q6IPE2, Q9H8H4, Q9H9F1
Gene ID:
Mouse(72454) coiled-coil domain containing 71
Rat(498678) coiled-coil domain containing 71
chicken(100858691) coiled-coil domain containing 71
cow(508336) coiled-coil domain containing 71
domestic cat(101082298) coiled-coil domain containing 71
dog(608874) coiled-coil domain containing 71
sheep(101106467) coiled-coil domain containing 71
domestic guinea pig(100727708) coiled-coil domain containing 71
naked mole-rat(101707120) coiled-coil domain containing 71
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133744 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133744 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133744 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022903 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022903 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022903 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU095371 MISSION® esiRNA esiRNA human CCDC71 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022903 Rosetta Predictions human pricing
NM_001024904 Rosetta Predictions rat pricing
NM_133744 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022903 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00356193 predicted 1479
2 SASI_Hs02_00356194 predicted 1479
3 SASI_Hs02_00356195 predicted 1523
4 SASI_Hs02_00356196 predicted 1405
5 SASI_Hs02_00356197 predicted 558
6 SASI_Hs01_00117928 predicted 338
7 SASI_Hs01_00117929 predicted 295
8 SASI_Hs02_00356198 predicted 746
9 SASI_Hs01_00117930 predicted 481
10 SASI_Hs02_00356199 predicted 1486
11 SASI_Hs01_00117931 predicted 680
12 SASI_Hs01_00117932 predicted 732
13 SASI_Hs01_00117933 predicted 1383
14 SASI_Hs01_00117934 predicted 295
15 SASI_Hs01_00117935 predicted 614
16 SASI_Hs01_00117936 predicted 545
17 SASI_Hs01_00117937 predicted 393
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024904 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00041884 predicted 294
2 SASI_Rn01_00041885 predicted 1358
3 SASI_Rn01_00041886 predicted 636
4 SASI_Rn01_00041887 predicted 1317
5 SASI_Rn01_00041888 predicted 1295
6 SASI_Rn01_00041889 predicted 683
7 SASI_Rn02_00202806 predicted 1104
8 SASI_Rn01_00041890 predicted 1301
9 SASI_Rn02_00202807 predicted 1288
10 SASI_Rn01_00041891 predicted 724
11 SASI_Rn01_00041892 predicted 1198
12 SASI_Rn01_00041893 predicted 957
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133744 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00191762 predicted 757
2 SASI_Mm01_00191763 predicted 351
3 SASI_Mm01_00191764 predicted 1342
4 SASI_Mm01_00191765 predicted 1124
5 SASI_Mm01_00191766 predicted 946
6 SASI_Mm01_00191767 predicted 1506
7 SASI_Mm01_00191768 predicted 1318
8 SASI_Mm01_00191769 predicted 1341
9 SASI_Mm01_00191770 predicted 970
10 SASI_Mm01_00191771 predicted 1389
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133744
CCDC71 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 71
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133744.4-1329s21c1
Sequence:CCGGCGAAAGTCCCAGACCATAAAGCTCGAGCTTTATGGTCTGGGACTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133744.4-698s21c1
Sequence:CCGGGACTCCCTGCTTGGACGTTAACTCGAGTTAACGTCCAAGCAGGGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133744.4-353s21c1
Sequence:CCGGTGGAGATGTCTATGGTTATAGCTCGAGCTATAACCATAGACATCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133744.4-949s21c1
Sequence:CCGGCATCTCAAACCCTGATCAAAGCTCGAGCTTTGATCAGGGTTTGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238123    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133744.4-2668s21c1
Sequence:CCGGCTGGCCAATCACGGGAATTAACTCGAGTTAATTCCCGTGATTGGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133744
CCDC71 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 71
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133744.4-1329s21c1
Sequence:CCGGCGAAAGTCCCAGACCATAAAGCTCGAGCTTTATGGTCTGGGACTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133744.4-698s21c1
Sequence:CCGGGACTCCCTGCTTGGACGTTAACTCGAGTTAACGTCCAAGCAGGGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133744.4-353s21c1
Sequence:CCGGTGGAGATGTCTATGGTTATAGCTCGAGCTATAACCATAGACATCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133744.4-949s21c1
Sequence:CCGGCATCTCAAACCCTGATCAAAGCTCGAGCTTTGATCAGGGTTTGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238123    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133744.4-2668s21c1
Sequence:CCGGCTGGCCAATCACGGGAATTAACTCGAGTTAATTCCCGTGATTGGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133744
CCDC71 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 71
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133744.4-1329s21c1
Sequence:CCGGCGAAAGTCCCAGACCATAAAGCTCGAGCTTTATGGTCTGGGACTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133744.4-698s21c1
Sequence:CCGGGACTCCCTGCTTGGACGTTAACTCGAGTTAACGTCCAAGCAGGGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133744.4-353s21c1
Sequence:CCGGTGGAGATGTCTATGGTTATAGCTCGAGCTATAACCATAGACATCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133744.4-949s21c1
Sequence:CCGGCATCTCAAACCCTGATCAAAGCTCGAGCTTTGATCAGGGTTTGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238123    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133744.4-2668s21c1
Sequence:CCGGCTGGCCAATCACGGGAATTAACTCGAGTTAATTCCCGTGATTGGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022903
VALIDATED
CCDC71 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 71
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000236047    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022903.3-1611s21c1
Sequence:CCGGATGTCCGTGGACTCCACAATCCTCGAGGATTGTGGAGTCCACGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022903.3-339s21c1
Sequence:CCGGTGGTGATGTCTATGGCTATAGCTCGAGCTATAGCCATAGACATCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022903.3-1486s21c1
Sequence:CCGGGTGAACCTGTCACCTGTAATACTCGAGTATTACAGGTGACAGGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_022903.3-1416s21c1
Sequence:CCGGCCGTGCCATAAAGGTAGATAGCTCGAGCTATCTACCTTTATGGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_022903.3-675s21c1
Sequence:CCGGTGAGGCCCTGGTTCCACTTAACTCGAGTTAAGTGGAACCAGGGCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022903.2-596s1c1
Sequence:CCGGCCACCTTTATCCAGGTGTCTACTCGAGTAGACACCTGGATAAAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022903.2-1454s1c1
Sequence:CCGGCGTGAACCTGTCACCTGTAATCTCGAGATTACAGGTGACAGGTTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_022903.2-813s1c1
Sequence:CCGGCCCAAGTGTCTGACTCGCAAACTCGAGTTTGCGAGTCAGACACTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022903.2-322s1c1
Sequence:CCGGGCTATAGTTCATGCACAGCTACTCGAGTAGCTGTGCATGAACTATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022903.2-1376s1c1
Sequence:CCGGGCTGAAGTTCCGTGCCATAAACTCGAGTTTATGGCACGGAACTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022903
VALIDATED
CCDC71 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 71
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000236047    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022903.3-1611s21c1
Sequence:CCGGATGTCCGTGGACTCCACAATCCTCGAGGATTGTGGAGTCCACGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022903.3-339s21c1
Sequence:CCGGTGGTGATGTCTATGGCTATAGCTCGAGCTATAGCCATAGACATCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022903.3-1486s21c1
Sequence:CCGGGTGAACCTGTCACCTGTAATACTCGAGTATTACAGGTGACAGGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_022903.3-1416s21c1
Sequence:CCGGCCGTGCCATAAAGGTAGATAGCTCGAGCTATCTACCTTTATGGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_022903.3-675s21c1
Sequence:CCGGTGAGGCCCTGGTTCCACTTAACTCGAGTTAAGTGGAACCAGGGCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022903.2-596s1c1
Sequence:CCGGCCACCTTTATCCAGGTGTCTACTCGAGTAGACACCTGGATAAAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022903.2-1454s1c1
Sequence:CCGGCGTGAACCTGTCACCTGTAATCTCGAGATTACAGGTGACAGGTTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_022903.2-813s1c1
Sequence:CCGGCCCAAGTGTCTGACTCGCAAACTCGAGTTTGCGAGTCAGACACTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022903.2-322s1c1
Sequence:CCGGGCTATAGTTCATGCACAGCTACTCGAGTAGCTGTGCATGAACTATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022903.2-1376s1c1
Sequence:CCGGGCTGAAGTTCCGTGCCATAAACTCGAGTTTATGGCACGGAACTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022903
VALIDATED
CCDC71 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 71
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000236047    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022903.3-1611s21c1
Sequence:CCGGATGTCCGTGGACTCCACAATCCTCGAGGATTGTGGAGTCCACGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022903.3-339s21c1
Sequence:CCGGTGGTGATGTCTATGGCTATAGCTCGAGCTATAGCCATAGACATCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022903.3-1486s21c1
Sequence:CCGGGTGAACCTGTCACCTGTAATACTCGAGTATTACAGGTGACAGGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_022903.3-1416s21c1
Sequence:CCGGCCGTGCCATAAAGGTAGATAGCTCGAGCTATCTACCTTTATGGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_022903.3-675s21c1
Sequence:CCGGTGAGGCCCTGGTTCCACTTAACTCGAGTTAAGTGGAACCAGGGCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022903.2-596s1c1
Sequence:CCGGCCACCTTTATCCAGGTGTCTACTCGAGTAGACACCTGGATAAAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022903.2-1454s1c1
Sequence:CCGGCGTGAACCTGTCACCTGTAATCTCGAGATTACAGGTGACAGGTTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_022903.2-813s1c1
Sequence:CCGGCCCAAGTGTCTGACTCGCAAACTCGAGTTTGCGAGTCAGACACTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022903.2-322s1c1
Sequence:CCGGGCTATAGTTCATGCACAGCTACTCGAGTAGCTGTGCATGAACTATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022903.2-1376s1c1
Sequence:CCGGGCTGAAGTTCCGTGCCATAAACTCGAGTTTATGGCACGGAACTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks