EMAIL THIS PAGE TO A FRIEND

CCDC71L

coiled-coil domain containing 71-like

200 Gene Product Result for
Synonyms: C7orf74
UniProtKB ID: Q8N9Z2, Q7Z756
Gene ID:
Mouse(72123) coiled-coil domain containing 71 like
Rat(500640) coiled-coil domain containing 71-like
chicken(101665756) coiled-coil domain containing 71-like
dog(609657) coiled-coil domain containing 71-like
chicken(101750427) coiled-coil domain containing 71-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA067925 Anti-CCDC71L antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175884 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_175884 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_175884 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028111 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028111 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028111 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001162903 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001162903 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001162903 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU100831 MISSION® esiRNA esiRNA human AC004917.2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_175884 Rosetta Predictions human pricing
XM_576015 Rosetta Predictions rat pricing
XR_009070 Rosetta Predictions rat pricing
NM_028111 Rosetta Predictions mouse pricing
XR_035317 Rosetta Predictions mouse pricing
XR_035455 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175884 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00017204 predicted 1441
2 SASI_Hs01_00017205 predicted 1340
3 SASI_Hs01_00017206 predicted 1074
4 SASI_Hs01_00017207 predicted 1371
5 SASI_Hs01_00017208 predicted 1021
6 SASI_Hs01_00017209 predicted 1434
7 SASI_Hs01_00017210 predicted 530
8 SASI_Hs02_00369159 predicted 1359
9 SASI_Hs01_00017211 predicted 511
10 SASI_Hs01_00017212 predicted 362
11 SASI_Hs01_00017213 predicted 1300
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576015 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00404617 predicted 803
2 SASI_Rn02_00404618 predicted 365
3 SASI_Rn02_00404619 predicted 1222
4 SASI_Rn02_00404620 predicted 1190
5 SASI_Rn02_00404621 predicted 816
6 SASI_Rn02_00404622 predicted 800
7 SASI_Rn02_00404623 predicted 344
8 SASI_Rn02_00404624 predicted 984
9 SASI_Rn02_00404625 predicted 801
10 SASI_Rn02_00404626 predicted 43
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_009070 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00166233 predicted 1468
2 SASI_Rn01_00166234 predicted 2366
3 SASI_Rn01_00166235 predicted 2506
4 SASI_Rn01_00166236 predicted 1452
5 SASI_Rn01_00166237 predicted 1558
6 SASI_Rn01_00166238 predicted 1958
7 SASI_Rn01_00166239 predicted 1620
8 SASI_Rn01_00166240 predicted 2419
9 SASI_Rn01_00166241 predicted 514
10 SASI_Rn02_00418673 predicted 2341
11 SASI_Rn01_00166242 predicted 2531
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028111 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00030847 predicted 314
2 SASI_Mm01_00030848 predicted 464
3 SASI_Mm01_00030849 predicted 475
4 SASI_Mm01_00030850 predicted 441
5 SASI_Mm01_00030851 predicted 573
6 SASI_Mm01_00030852 predicted 571
7 SASI_Mm01_00030853 predicted 584
8 SASI_Mm01_00030854 predicted 217
9 SASI_Mm01_00030855 predicted 314
10 SASI_Mm01_00030856 predicted 539
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_035317 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00481569 predicted 1989
2 SASI_Mm02_00481570 predicted 1928
3 SASI_Mm02_00481571 predicted 2088
4 SASI_Mm02_00481572 predicted 2948
5 SASI_Mm02_00481573 predicted 1834
6 SASI_Mm02_00481574 predicted 1436
7 SASI_Mm02_00481575 predicted 2850
8 SASI_Mm02_00481576 predicted 1387
9 SASI_Mm02_00481577 predicted 918
10 SASI_Mm02_00481578 predicted 2237
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_035455 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00482883 predicted 1987
2 SASI_Mm02_00482884 predicted 1928
3 SASI_Mm02_00482885 predicted 2087
4 SASI_Mm02_00482886 predicted 2948
5 SASI_Mm02_00482887 predicted 1840
6 SASI_Mm02_00482888 predicted 1434
7 SASI_Mm02_00482889 predicted 2854
8 SASI_Mm02_00482890 predicted 1392
9 SASI_Mm02_00482891 predicted 916
10 SASI_Mm02_00482892 predicted 2237
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175884
VALIDATED
CCDC71L MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 71-like
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168289    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175884.3-1560s1c1
Sequence:CCGGGACTGTTAGTAGTGCAAGGATCTCGAGATCCTTGCACTACTAACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167540    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175884.3-1357s1c1
Sequence:CCGGGCTTGTGTAATAAAGCCAGAACTCGAGTTCTGGCTTTATTACACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167013    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175884.3-1997s1c1
Sequence:CCGGGATGGATGTGTGTAAACATTACTCGAGTAATGTTTACACACATCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263455    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175884.3-1901s21c1
Sequence:CCGGCTAGGAATATTATGCGTTAAACTCGAGTTTAACGCATAATATTCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_175884.3-903s21c1
Sequence:CCGGAGTGAACCTGGAACCCATGGTCTCGAGACCATGGGTTCCAGGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_175884.3-533s21c1
Sequence:CCGGGCAAGGACGTCTACGGCTACTCTCGAGAGTAGCCGTAGACGTCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175884.3-420s21c1
Sequence:CCGGCGACGCCTTCAAGCTCTTCATCTCGAGATGAAGAGCTTGAAGGCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175884
VALIDATED
CCDC71L MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 71-like
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168289    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175884.3-1560s1c1
Sequence:CCGGGACTGTTAGTAGTGCAAGGATCTCGAGATCCTTGCACTACTAACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167540    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175884.3-1357s1c1
Sequence:CCGGGCTTGTGTAATAAAGCCAGAACTCGAGTTCTGGCTTTATTACACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167013    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175884.3-1997s1c1
Sequence:CCGGGATGGATGTGTGTAAACATTACTCGAGTAATGTTTACACACATCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263455    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175884.3-1901s21c1
Sequence:CCGGCTAGGAATATTATGCGTTAAACTCGAGTTTAACGCATAATATTCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_175884.3-903s21c1
Sequence:CCGGAGTGAACCTGGAACCCATGGTCTCGAGACCATGGGTTCCAGGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_175884.3-533s21c1
Sequence:CCGGGCAAGGACGTCTACGGCTACTCTCGAGAGTAGCCGTAGACGTCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175884.3-420s21c1
Sequence:CCGGCGACGCCTTCAAGCTCTTCATCTCGAGATGAAGAGCTTGAAGGCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175884
VALIDATED
CCDC71L MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 71-like
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168289    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175884.3-1560s1c1
Sequence:CCGGGACTGTTAGTAGTGCAAGGATCTCGAGATCCTTGCACTACTAACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167540    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175884.3-1357s1c1
Sequence:CCGGGCTTGTGTAATAAAGCCAGAACTCGAGTTCTGGCTTTATTACACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167013    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175884.3-1997s1c1
Sequence:CCGGGATGGATGTGTGTAAACATTACTCGAGTAATGTTTACACACATCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263455    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175884.3-1901s21c1
Sequence:CCGGCTAGGAATATTATGCGTTAAACTCGAGTTTAACGCATAATATTCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_175884.3-903s21c1
Sequence:CCGGAGTGAACCTGGAACCCATGGTCTCGAGACCATGGGTTCCAGGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_175884.3-533s21c1
Sequence:CCGGGCAAGGACGTCTACGGCTACTCTCGAGAGTAGCCGTAGACGTCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175884.3-420s21c1
Sequence:CCGGCGACGCCTTCAAGCTCTTCATCTCGAGATGAAGAGCTTGAAGGCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028111
CCDC71L MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 71-like
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000183270    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028111.1-617s1c1
Sequence:CCGGGCTCAGTGATTAACAAGAGATCTCGAGATCTCTTGTTAATCACTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182890    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028111.1-365s1c1
Sequence:CCGGCTTGTGTAATACAGCCAGAATCTCGAGATTCTGGCTGTATTACACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184778    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028111.1-361s1c1
Sequence:CCGGCGTGCTTGTGTAATACAGCCACTCGAGTGGCTGTATTACACAAGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028111
CCDC71L MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 71-like
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000183270    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028111.1-617s1c1
Sequence:CCGGGCTCAGTGATTAACAAGAGATCTCGAGATCTCTTGTTAATCACTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182890    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028111.1-365s1c1
Sequence:CCGGCTTGTGTAATACAGCCAGAATCTCGAGATTCTGGCTGTATTACACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184778    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028111.1-361s1c1
Sequence:CCGGCGTGCTTGTGTAATACAGCCACTCGAGTGGCTGTATTACACAAGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028111
CCDC71L MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 71-like
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000183270    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028111.1-617s1c1
Sequence:CCGGGCTCAGTGATTAACAAGAGATCTCGAGATCTCTTGTTAATCACTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182890    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028111.1-365s1c1
Sequence:CCGGCTTGTGTAATACAGCCAGAATCTCGAGATTCTGGCTGTATTACACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184778    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028111.1-361s1c1
Sequence:CCGGCGTGCTTGTGTAATACAGCCACTCGAGTGGCTGTATTACACAAGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001162903
CCDC71L MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 71-like
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437111    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001162903.1-959s21c1
Sequence:CCGGGTGCACTTTATGCGCGAACTACTCGAGTAGTTCGCGCATAAAGTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437081    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001162903.1-1071s21c1
Sequence:CCGGAGAAGTCCCTTTGCTTCCCAACTCGAGTTGGGAAGCAAAGGGACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162903.1-357s21c1
Sequence:CCGGCTTCAAGCTCTTCATGCCCAGCTCGAGCTGGGCATGAAGAGCTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162903.1-302s21c1
Sequence:CCGGTGTACTCGCGGTCGCAACTGTCTCGAGACAGTTGCGACCGCGAGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162903.1-382s21c1
Sequence:CCGGACGGAGTTCATGAGCTCGGAACTCGAGTTCCGAGCTCATGAACTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435738    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001162903.1-1310s21c1
Sequence:CCCGGACTATGTTTCCTGGTGAAGTCTCGAGACTTCACCAGGAAACATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162903.1-464s21c1
Sequence:CCGGGCAAGGACGTCTACGGCTACTCTCGAGAGTAGCCGTAGACGTCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001162903
CCDC71L MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 71-like
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437111    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001162903.1-959s21c1
Sequence:CCGGGTGCACTTTATGCGCGAACTACTCGAGTAGTTCGCGCATAAAGTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437081    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001162903.1-1071s21c1
Sequence:CCGGAGAAGTCCCTTTGCTTCCCAACTCGAGTTGGGAAGCAAAGGGACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162903.1-357s21c1
Sequence:CCGGCTTCAAGCTCTTCATGCCCAGCTCGAGCTGGGCATGAAGAGCTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162903.1-302s21c1
Sequence:CCGGTGTACTCGCGGTCGCAACTGTCTCGAGACAGTTGCGACCGCGAGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162903.1-382s21c1
Sequence:CCGGACGGAGTTCATGAGCTCGGAACTCGAGTTCCGAGCTCATGAACTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435738    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001162903.1-1310s21c1
Sequence:CCCGGACTATGTTTCCTGGTGAAGTCTCGAGACTTCACCAGGAAACATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162903.1-464s21c1
Sequence:CCGGGCAAGGACGTCTACGGCTACTCTCGAGAGTAGCCGTAGACGTCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001162903
CCDC71L MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 71-like
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437111    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001162903.1-959s21c1
Sequence:CCGGGTGCACTTTATGCGCGAACTACTCGAGTAGTTCGCGCATAAAGTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437081    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001162903.1-1071s21c1
Sequence:CCGGAGAAGTCCCTTTGCTTCCCAACTCGAGTTGGGAAGCAAAGGGACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162903.1-357s21c1
Sequence:CCGGCTTCAAGCTCTTCATGCCCAGCTCGAGCTGGGCATGAAGAGCTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162903.1-302s21c1
Sequence:CCGGTGTACTCGCGGTCGCAACTGTCTCGAGACAGTTGCGACCGCGAGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162903.1-382s21c1
Sequence:CCGGACGGAGTTCATGAGCTCGGAACTCGAGTTCCGAGCTCATGAACTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435738    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001162903.1-1310s21c1
Sequence:CCCGGACTATGTTTCCTGGTGAAGTCTCGAGACTTCACCAGGAAACATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162903.1-464s21c1
Sequence:CCGGGCAAGGACGTCTACGGCTACTCTCGAGAGTAGCCGTAGACGTCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks