EMAIL THIS PAGE TO A FRIEND

CCDC73

coiled-coil domain containing 73

73 Gene Product Result for
Synonyms: NY-SAR-79
UniProtKB ID: Q6ZRK6, Q6P5Q7, Q6ZMW0, Q86WE7
Gene ID:
Mouse(211936) coiled-coil domain containing 73
Rat(499848) coiled-coil domain containing 73
Zebrafish(564263) coiled-coil domain containing 73
cow(521905) coiled-coil domain containing 73
Horse(100072723) coiled-coil domain containing 73
domestic cat(101090462) coiled-coil domain containing 73
dog(483438) coiled-coil domain containing 73
chicken(421601) coiled-coil domain containing 73
domestic guinea pig(100716427) coiled-coil domain containing 73
naked mole-rat(101715717) coiled-coil domain containing 73
sheep(101122132) coiled-coil domain containing 73
Domestic Rabbit(100347297) coiled-coil domain containing 73
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177600 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177600 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177600 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001008391 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001008391 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001008391 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU075911 MISSION® esiRNA esiRNA human CCDC73 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008391 Rosetta Predictions human pricing
XM_001079643 Rosetta Predictions rat pricing
XM_575188 Rosetta Predictions rat pricing
NM_177600 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008391 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00305417 predicted 904
2 SASI_Hs01_00013411 predicted 3304
3 SASI_Hs02_00305418 predicted 246
4 SASI_Hs02_00305419 predicted 843
5 SASI_Hs01_00013415 predicted 3276
6 SASI_Hs01_00013417 predicted 895
7 SASI_Hs01_00013418 predicted 1705
8 SASI_Hs01_00013419 predicted 3005
9 SASI_Hs02_00305420 predicted 732
10 SASI_Hs02_00305421 predicted 2647
11 SASI_Hs01_00013412 predicted 2883
12 SASI_Hs01_00013413 predicted 1116
13 SASI_Hs01_00013414 predicted 730
14 SASI_Hs01_00013416 predicted 2326
15 SASI_Hs01_00013420 predicted 2348
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079643 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00364955 predicted 1883
2 SASI_Rn02_00364956 predicted 705
3 SASI_Rn02_00364957 predicted 571
4 SASI_Rn02_00364958 predicted 2546
5 SASI_Rn02_00364959 predicted 1903
6 SASI_Rn02_00364960 predicted 773
7 SASI_Rn02_00364961 predicted 882
8 SASI_Rn02_00364962 predicted 1943
9 SASI_Rn02_00364963 predicted 2285
10 SASI_Rn02_00364964 predicted 2251
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575188 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00403211 predicted 1905
2 SASI_Rn02_00403212 predicted 733
3 SASI_Rn02_00403213 predicted 593
4 SASI_Rn02_00403214 predicted 2571
5 SASI_Rn02_00403215 predicted 1922
6 SASI_Rn02_00403216 predicted 793
7 SASI_Rn02_00403217 predicted 908
8 SASI_Rn02_00403218 predicted 1974
9 SASI_Rn02_00403219 predicted 2310
10 SASI_Rn02_00403220 predicted 2271
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177600 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00347795 predicted 755
2 SASI_Mm01_00169856 predicted 1675
3 SASI_Mm01_00169857 predicted 1979
4 SASI_Mm01_00169858 predicted 2129
5 SASI_Mm01_00169859 predicted 1692
6 SASI_Mm01_00169860 predicted 2127
7 SASI_Mm01_00169861 predicted 2968
8 SASI_Mm01_00169862 predicted 2300
9 SASI_Mm02_00347796 predicted 3226
10 SASI_Mm02_00347797 predicted 1206
11 SASI_Mm01_00169853 predicted 1122
12 SASI_Mm01_00169854 predicted 2348
13 SASI_Mm01_00169855 predicted 1165
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177600
CCDC73 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 73
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000216407    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177600.4-659s1c1
Sequence:CCGGGATTATCACAAGCAACTTAATCTCGAGATTAAGTTGCTTGTGATAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177600.2-1191s1c1
Sequence:CCGGCCCATTCAAACAGCAATCCAACTCGAGTTGGATTGCTGTTTGAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198340    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177600.2-2611s1c1
Sequence:CCGGGCTTTCATTAGTGAGGTTGATCTCGAGATCAACCTCACTAATGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177600.2-1276s1c1
Sequence:CCGGGCAGGTTTAGATTCATTTCTACTCGAGTAGAAATGAATCTAAACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177600.2-899s1c1
Sequence:CCGGCCTCAGATGTTACTGACAGTACTCGAGTACTGTCAGTAACATCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178601    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177600.2-2941s1c1
Sequence:CCGGCCCTCATTAGTTCCTTTCTTTCTCGAGAAAGAAAGGAACTAATGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177493    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177600.2-2496s1c1
Sequence:CCGGGATGAATAGACTCACTGAAATCTCGAGATTTCAGTGAGTCTATTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176577    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177600.2-1318s1c1
Sequence:CCGGCCATGTAAGAAACATGGTTTACTCGAGTAAACCATGTTTCTTACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177600
CCDC73 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 73
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000216407    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177600.4-659s1c1
Sequence:CCGGGATTATCACAAGCAACTTAATCTCGAGATTAAGTTGCTTGTGATAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177600.2-1191s1c1
Sequence:CCGGCCCATTCAAACAGCAATCCAACTCGAGTTGGATTGCTGTTTGAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198340    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177600.2-2611s1c1
Sequence:CCGGGCTTTCATTAGTGAGGTTGATCTCGAGATCAACCTCACTAATGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177600.2-1276s1c1
Sequence:CCGGGCAGGTTTAGATTCATTTCTACTCGAGTAGAAATGAATCTAAACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177600.2-899s1c1
Sequence:CCGGCCTCAGATGTTACTGACAGTACTCGAGTACTGTCAGTAACATCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178601    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177600.2-2941s1c1
Sequence:CCGGCCCTCATTAGTTCCTTTCTTTCTCGAGAAAGAAAGGAACTAATGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177493    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177600.2-2496s1c1
Sequence:CCGGGATGAATAGACTCACTGAAATCTCGAGATTTCAGTGAGTCTATTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176577    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177600.2-1318s1c1
Sequence:CCGGCCATGTAAGAAACATGGTTTACTCGAGTAAACCATGTTTCTTACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177600
CCDC73 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 73
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000216407    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177600.4-659s1c1
Sequence:CCGGGATTATCACAAGCAACTTAATCTCGAGATTAAGTTGCTTGTGATAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177600.2-1191s1c1
Sequence:CCGGCCCATTCAAACAGCAATCCAACTCGAGTTGGATTGCTGTTTGAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198340    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177600.2-2611s1c1
Sequence:CCGGGCTTTCATTAGTGAGGTTGATCTCGAGATCAACCTCACTAATGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177600.2-1276s1c1
Sequence:CCGGGCAGGTTTAGATTCATTTCTACTCGAGTAGAAATGAATCTAAACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177600.2-899s1c1
Sequence:CCGGCCTCAGATGTTACTGACAGTACTCGAGTACTGTCAGTAACATCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178601    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177600.2-2941s1c1
Sequence:CCGGCCCTCATTAGTTCCTTTCTTTCTCGAGAAAGAAAGGAACTAATGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177493    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177600.2-2496s1c1
Sequence:CCGGGATGAATAGACTCACTGAAATCTCGAGATTTCAGTGAGTCTATTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176577    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177600.2-1318s1c1
Sequence:CCGGCCATGTAAGAAACATGGTTTACTCGAGTAAACCATGTTTCTTACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001008391
CCDC73 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 73
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000167696    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001008391.1-2657s1c1
Sequence:CCGGGTATTACTCTACTTCTGTCTTCTCGAGAAGACAGAAGTAGAGTAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166841    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001008391.1-2710s1c1
Sequence:CCGGCATTGCTTCTTCAATATCCTTCTCGAGAAGGATATTGAAGAAGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008391.1-2355s1c1
Sequence:CCGGGCAGGCAATCAAGACGACTAACTCGAGTTAGTCGTCTTGATTGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008391.1-1387s1c1
Sequence:CCGGGATATAGTAATCGACCACCATCTCGAGATGGTGGTCGATTACTATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008391.1-622s1c1
Sequence:CCGGGAAGGCTCATTTATAGAGGAACTCGAGTTCCTCTATAAATGAGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008391.1-184s1c1
Sequence:CCGGGAGGCAGAATTGAAGGTGCTACTCGAGTAGCACCTTCAATTCTGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001008391
CCDC73 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 73
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000167696    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001008391.1-2657s1c1
Sequence:CCGGGTATTACTCTACTTCTGTCTTCTCGAGAAGACAGAAGTAGAGTAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166841    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001008391.1-2710s1c1
Sequence:CCGGCATTGCTTCTTCAATATCCTTCTCGAGAAGGATATTGAAGAAGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008391.1-2355s1c1
Sequence:CCGGGCAGGCAATCAAGACGACTAACTCGAGTTAGTCGTCTTGATTGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008391.1-1387s1c1
Sequence:CCGGGATATAGTAATCGACCACCATCTCGAGATGGTGGTCGATTACTATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008391.1-622s1c1
Sequence:CCGGGAAGGCTCATTTATAGAGGAACTCGAGTTCCTCTATAAATGAGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008391.1-184s1c1
Sequence:CCGGGAGGCAGAATTGAAGGTGCTACTCGAGTAGCACCTTCAATTCTGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001008391
CCDC73 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 73
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000167696    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001008391.1-2657s1c1
Sequence:CCGGGTATTACTCTACTTCTGTCTTCTCGAGAAGACAGAAGTAGAGTAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166841    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001008391.1-2710s1c1
Sequence:CCGGCATTGCTTCTTCAATATCCTTCTCGAGAAGGATATTGAAGAAGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008391.1-2355s1c1
Sequence:CCGGGCAGGCAATCAAGACGACTAACTCGAGTTAGTCGTCTTGATTGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008391.1-1387s1c1
Sequence:CCGGGATATAGTAATCGACCACCATCTCGAGATGGTGGTCGATTACTATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008391.1-622s1c1
Sequence:CCGGGAAGGCTCATTTATAGAGGAACTCGAGTTCCTCTATAAATGAGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008391.1-184s1c1
Sequence:CCGGGAGGCAGAATTGAAGGTGCTACTCGAGTAGCACCTTCAATTCTGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks