EMAIL THIS PAGE TO A FRIEND

CCDC74A

coiled-coil domain containing 74A

36 Gene Product Result for
UniProtKB ID: Q96AQ1, Q6P4I5
Gene ID:
Mouse(72315) coiled-coil domain containing 74A
Rat(680752) coiled-coil domain containing 74A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2100355 Anti-CCDC74A antibody produced in rabbit affinity isolated antibody human, horse, rabbit
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138770 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138770 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138770 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138770 Rosetta Predictions human pricing
XM_001058720 Rosetta Predictions rat pricing
XM_354949 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138770 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00046048 predicted 1225
2 SASI_Hs01_00046049 predicted 566
3 SASI_Hs01_00046050 predicted 1082
4 SASI_Hs01_00046051 predicted 859
5 SASI_Hs01_00046052 predicted 307
6 SASI_Hs01_00046053 predicted 1028
7 SASI_Hs01_00046054 predicted 621
8 SASI_Hs01_00046055 predicted 1001
9 SASI_Hs01_00046056 predicted 560
10 SASI_Hs01_00046057 predicted 987
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058720 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00290639 predicted 200
2 SASI_Rn02_00290640 predicted 195
3 SASI_Rn02_00290641 predicted 1296
4 SASI_Rn02_00290642 predicted 358
5 SASI_Rn02_00290643 predicted 424
6 SASI_Rn02_00290644 predicted 1043
7 SASI_Rn02_00290645 predicted 452
8 SASI_Rn02_00290646 predicted 1262
9 SASI_Rn02_00290647 predicted 1036
10 SASI_Rn02_00290648 predicted 435
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_354949 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00246123 predicted 1057
2 SASI_Mm01_00246124 predicted 1061
3 SASI_Mm01_00246125 predicted 761
4 SASI_Mm01_00246126 predicted 459
5 SASI_Mm01_00246127 predicted 488
6 SASI_Mm01_00246128 predicted 576
7 SASI_Mm01_00246129 predicted 1079
8 SASI_Mm01_00246130 predicted 889
9 SASI_Mm01_00246131 predicted 470
10 SASI_Mm01_00246132 predicted 537
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138770
CCDC74A MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 74A
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166043    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138770.1-1113s1c1
Sequence:CCGGCGAAGAACAACTTTGCCGAGACTCGAGTCTCGGCAAAGTTGTTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159926    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138770.1-1299s1c1
Sequence:CCGGCAGATAACACTCAAGATAGATCTCGAGATCTATCTTGAGTGTTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158534    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138770.1-307s1c1
Sequence:CCGGCCATTACAAGCTCATAATGAACTCGAGTTCATTATGAGCTTGTAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160738    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138770.1-621s1c1
Sequence:CCGGCCTTCAACAAGCAAGATTCAACTCGAGTTGAATCTTGCTTGTTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165115    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138770.1-1038s1c1
Sequence:CCGGCCAAGAGCCTCTCCAAGAAATCTCGAGATTTCTTGGAGAGGCTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163567    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138770.1-618s1c1
Sequence:CCGGGCTCCTTCAACAAGCAAGATTCTCGAGAATCTTGCTTGTTGAAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161188    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138770.1-325s1c1
Sequence:CCGGGAATCAGACATCACAGAAGAACTCGAGTTCTTCTGTGATGTCTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163504    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138770.1-571s1c1
Sequence:CCGGGTCTGTCAAGTCCATCTCTAACTCGAGTTAGAGATGGACTTGACAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165946    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138770.1-740s1c1
Sequence:CCGGGAGAAAGCAGAGGCCTCTAATCTCGAGATTAGAGGCCTCTGCTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138770
CCDC74A MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 74A
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166043    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138770.1-1113s1c1
Sequence:CCGGCGAAGAACAACTTTGCCGAGACTCGAGTCTCGGCAAAGTTGTTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159926    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138770.1-1299s1c1
Sequence:CCGGCAGATAACACTCAAGATAGATCTCGAGATCTATCTTGAGTGTTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158534    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138770.1-307s1c1
Sequence:CCGGCCATTACAAGCTCATAATGAACTCGAGTTCATTATGAGCTTGTAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160738    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138770.1-621s1c1
Sequence:CCGGCCTTCAACAAGCAAGATTCAACTCGAGTTGAATCTTGCTTGTTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165115    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138770.1-1038s1c1
Sequence:CCGGCCAAGAGCCTCTCCAAGAAATCTCGAGATTTCTTGGAGAGGCTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163567    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138770.1-618s1c1
Sequence:CCGGGCTCCTTCAACAAGCAAGATTCTCGAGAATCTTGCTTGTTGAAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161188    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138770.1-325s1c1
Sequence:CCGGGAATCAGACATCACAGAAGAACTCGAGTTCTTCTGTGATGTCTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163504    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138770.1-571s1c1
Sequence:CCGGGTCTGTCAAGTCCATCTCTAACTCGAGTTAGAGATGGACTTGACAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165946    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138770.1-740s1c1
Sequence:CCGGGAGAAAGCAGAGGCCTCTAATCTCGAGATTAGAGGCCTCTGCTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138770
CCDC74A MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 74A
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166043    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138770.1-1113s1c1
Sequence:CCGGCGAAGAACAACTTTGCCGAGACTCGAGTCTCGGCAAAGTTGTTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159926    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138770.1-1299s1c1
Sequence:CCGGCAGATAACACTCAAGATAGATCTCGAGATCTATCTTGAGTGTTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158534    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138770.1-307s1c1
Sequence:CCGGCCATTACAAGCTCATAATGAACTCGAGTTCATTATGAGCTTGTAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160738    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138770.1-621s1c1
Sequence:CCGGCCTTCAACAAGCAAGATTCAACTCGAGTTGAATCTTGCTTGTTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165115    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138770.1-1038s1c1
Sequence:CCGGCCAAGAGCCTCTCCAAGAAATCTCGAGATTTCTTGGAGAGGCTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163567    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138770.1-618s1c1
Sequence:CCGGGCTCCTTCAACAAGCAAGATTCTCGAGAATCTTGCTTGTTGAAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161188    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138770.1-325s1c1
Sequence:CCGGGAATCAGACATCACAGAAGAACTCGAGTTCTTCTGTGATGTCTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163504    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138770.1-571s1c1
Sequence:CCGGGTCTGTCAAGTCCATCTCTAACTCGAGTTAGAGATGGACTTGACAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165946    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138770.1-740s1c1
Sequence:CCGGGAGAAAGCAGAGGCCTCTAATCTCGAGATTAGAGGCCTCTGCTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks