EMAIL THIS PAGE TO A FRIEND

CCDC74B

coiled-coil domain containing 74B

16 Gene Product Result for
UniProtKB ID: Q96LY2, Q6NW18
Gene ID:
cow(789735) coiled-coil domain containing 74B
dog(608483) coiled-coil domain-containing protein 74B-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302258 ANTI-CCDC74B (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207310 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207310 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207310 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207310 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207310 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00017584 predicted 315
2 SASI_Hs01_00017585 predicted 306
3 SASI_Hs02_00373835 predicted 531
4 SASI_Hs01_00017586 predicted 1097
5 SASI_Hs01_00017588 predicted 1175
6 SASI_Hs01_00017589 predicted 887
7 SASI_Hs01_00017590 predicted 1195
8 SASI_Hs01_00017591 predicted 631
9 SASI_Hs01_00017592 predicted 286
10 SASI_Hs01_00017593 predicted 1004
11 SASI_Hs01_00017587 predicted 580
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207310
CCDC74B MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 74B
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000173086    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207310.1-1060s1c1
Sequence:CCGGCCAAGAAATGCCTGCTTCTGACTCGAGTCAGAAGCAGGCATTTCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168673    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207310.1-312s1c1
Sequence:CCGGGATCTCCGTTACAAGCTCATACTCGAGTATGAGCTTGTAACGGAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172244    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207310.1-1056s1c1
Sequence:CCGGCTCTCCAAGAAATGCCTGCTTCTCGAGAAGCAGGCATTTCTTGGAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172877    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207310.1-569s1c1
Sequence:CCGGGTCAAGCTTCCAGTCTGTCAACTCGAGTTGACAGACTGGAAGCTTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207310.1-1013s21c1
Sequence:CCGGGGACCAAGAAGCCACGCATTTCTCGAGAAATGCGTGGCTTCTTGGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421947    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207310.1-1252s21c1
Sequence:CCGGGATTGGCTCTCTATAGCATTTCTCGAGAAATGCTATAGAGAGCCAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207310.1-1198s21c1
Sequence:CCGGTGCTTTGAGCTACCCGCATCTCTCGAGAGATGCGGGTAGCTCAAAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428068    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207310.1-1301s21c1
Sequence:CCGGGCTAAATTCCAAGATAGATAACTCGAGTTATCTATCTTGGAATTTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207310
CCDC74B MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 74B
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000173086    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207310.1-1060s1c1
Sequence:CCGGCCAAGAAATGCCTGCTTCTGACTCGAGTCAGAAGCAGGCATTTCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168673    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207310.1-312s1c1
Sequence:CCGGGATCTCCGTTACAAGCTCATACTCGAGTATGAGCTTGTAACGGAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172244    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207310.1-1056s1c1
Sequence:CCGGCTCTCCAAGAAATGCCTGCTTCTCGAGAAGCAGGCATTTCTTGGAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172877    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207310.1-569s1c1
Sequence:CCGGGTCAAGCTTCCAGTCTGTCAACTCGAGTTGACAGACTGGAAGCTTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207310.1-1013s21c1
Sequence:CCGGGGACCAAGAAGCCACGCATTTCTCGAGAAATGCGTGGCTTCTTGGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421947    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207310.1-1252s21c1
Sequence:CCGGGATTGGCTCTCTATAGCATTTCTCGAGAAATGCTATAGAGAGCCAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207310.1-1198s21c1
Sequence:CCGGTGCTTTGAGCTACCCGCATCTCTCGAGAGATGCGGGTAGCTCAAAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428068    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207310.1-1301s21c1
Sequence:CCGGGCTAAATTCCAAGATAGATAACTCGAGTTATCTATCTTGGAATTTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207310
CCDC74B MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 74B
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000173086    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207310.1-1060s1c1
Sequence:CCGGCCAAGAAATGCCTGCTTCTGACTCGAGTCAGAAGCAGGCATTTCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168673    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207310.1-312s1c1
Sequence:CCGGGATCTCCGTTACAAGCTCATACTCGAGTATGAGCTTGTAACGGAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172244    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207310.1-1056s1c1
Sequence:CCGGCTCTCCAAGAAATGCCTGCTTCTCGAGAAGCAGGCATTTCTTGGAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172877    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207310.1-569s1c1
Sequence:CCGGGTCAAGCTTCCAGTCTGTCAACTCGAGTTGACAGACTGGAAGCTTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207310.1-1013s21c1
Sequence:CCGGGGACCAAGAAGCCACGCATTTCTCGAGAAATGCGTGGCTTCTTGGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421947    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207310.1-1252s21c1
Sequence:CCGGGATTGGCTCTCTATAGCATTTCTCGAGAAATGCTATAGAGAGCCAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207310.1-1198s21c1
Sequence:CCGGTGCTTTGAGCTACCCGCATCTCTCGAGAGATGCGGGTAGCTCAAAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428068    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207310.1-1301s21c1
Sequence:CCGGGCTAAATTCCAAGATAGATAACTCGAGTTATCTATCTTGGAATTTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)