EMAIL THIS PAGE TO A FRIEND

CCDC77

coiled-coil domain containing 77

UniProtKB ID: Q9BR77, B4DDE8
Gene ID:
Mouse(67200) coiled-coil domain containing 77
Rat(312677) coiled-coil domain containing 77
sheep(101120068) coiled-coil domain containing 77
Domestic Rabbit(100355372) coiled-coil domain containing 77
domestic guinea pig(100726793) coiled-coil domain containing 77
naked mole-rat(101698789) coiled-coil domain containing 77
Zebrafish(555400) coiled-coil domain containing 77
chicken(418149) coiled-coil domain containing 77
domestic cat(101087584) coiled-coil domain containing 77
dog(486749) coiled-coil domain containing 77
cow(527084) coiled-coil domain containing 77
Horse(100050386) coiled-coil domain containing 77
52 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA038854 Anti-CCDC77 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026028 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026028 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026028 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032358 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032358 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032358 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032358 Rosetta Predictions human pricing
XM_001058323 Rosetta Predictions rat pricing
XM_232333 Rosetta Predictions rat pricing
NM_026028 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032358 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00207673 predicted 1300
2 SASI_Hs01_00207674 predicted 375
3 SASI_Hs01_00207675 predicted 598
4 SASI_Hs01_00207676 predicted 1005
5 SASI_Hs01_00207677 predicted 320
6 SASI_Hs01_00207678 predicted 1631
7 SASI_Hs01_00207679 predicted 771
8 SASI_Hs01_00207680 predicted 563
9 SASI_Hs01_00207681 predicted 1365
10 SASI_Hs01_00207682 predicted 1091
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058323 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00289298 predicted 1282
2 SASI_Rn02_00289299 predicted 688
3 SASI_Rn02_00289300 predicted 621
4 SASI_Rn02_00289301 predicted 661
5 SASI_Rn02_00289302 predicted 319
6 SASI_Rn02_00289303 predicted 1441
7 SASI_Rn02_00289304 predicted 1117
8 SASI_Rn02_00289305 predicted 989
9 SASI_Rn02_00289306 predicted 1525
10 SASI_Rn02_00289307 predicted 1343
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_232333 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00387090 predicted 1469
2 SASI_Rn02_00387091 predicted 1329
3 SASI_Rn02_00387092 predicted 1322
4 SASI_Rn02_00387093 predicted 1328
5 SASI_Rn02_00387094 predicted 1373
6 SASI_Rn02_00387095 predicted 1427
7 SASI_Rn02_00387096 predicted 1454
8 SASI_Rn02_00387097 predicted 1292
9 SASI_Rn02_00387098 predicted 1355
10 SASI_Rn02_00387099 predicted 1468
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026028 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00050293 predicted 963
2 SASI_Mm01_00050294 predicted 985
3 SASI_Mm01_00050295 predicted 1256
4 SASI_Mm01_00050296 predicted 482
5 SASI_Mm01_00050297 predicted 1346
6 SASI_Mm01_00050298 predicted 371
7 SASI_Mm01_00050299 predicted 447
8 SASI_Mm01_00050300 predicted 253
9 SASI_Mm01_00050301 predicted 289
10 SASI_Mm01_00050302 predicted 756
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026028
VALIDATED
CCDC77 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 77
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000339837    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026028.4-1595s21c1
Sequence:CCGGCCAGAGTAGTGGCATCAATTTCTCGAGAAATTGATGCCACTACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026028.4-326s21c1
Sequence:CCGGGCATAAACTTGAGTGGAACTTCTCGAGAAGTTCCACTCAAGTTTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026028.4-982s21c1
Sequence:CCGGTGTCAAAGATTACGCAGTATACTCGAGTATACTGCGTAATCTTTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026028.4-132s21c1
Sequence:CCGGGATACCAACAGGTGGAAGAAACTCGAGTTTCTTCCACCTGTTGGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026028.1-313s1c1
Sequence:CCGGGCTTGCGAAGAGCAGCATAAACTCGAGTTTATGCTGCTCTTCGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026028.1-133s1c1
Sequence:CCGGGATACCAACAGGTGGAAGAAACTCGAGTTTCTTCCACCTGTTGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026028.1-327s1c1
Sequence:CCGGGCATAAACTTGAGTGGAACTTCTCGAGAAGTTCCACTCAAGTTTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198824    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026028.1-1596s1c1
Sequence:CCGGCCAGAGTAGTGGCATCAATTTCTCGAGAAATTGATGCCACTACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026028.1-1242s1c1
Sequence:CCGGGCGCTTACAGATAATGACAAACTCGAGTTTGTCATTATCTGTAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026028
VALIDATED
CCDC77 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 77
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000339837    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026028.4-1595s21c1
Sequence:CCGGCCAGAGTAGTGGCATCAATTTCTCGAGAAATTGATGCCACTACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026028.4-326s21c1
Sequence:CCGGGCATAAACTTGAGTGGAACTTCTCGAGAAGTTCCACTCAAGTTTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026028.4-982s21c1
Sequence:CCGGTGTCAAAGATTACGCAGTATACTCGAGTATACTGCGTAATCTTTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026028.4-132s21c1
Sequence:CCGGGATACCAACAGGTGGAAGAAACTCGAGTTTCTTCCACCTGTTGGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026028.1-313s1c1
Sequence:CCGGGCTTGCGAAGAGCAGCATAAACTCGAGTTTATGCTGCTCTTCGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026028.1-133s1c1
Sequence:CCGGGATACCAACAGGTGGAAGAAACTCGAGTTTCTTCCACCTGTTGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026028.1-327s1c1
Sequence:CCGGGCATAAACTTGAGTGGAACTTCTCGAGAAGTTCCACTCAAGTTTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198824    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026028.1-1596s1c1
Sequence:CCGGCCAGAGTAGTGGCATCAATTTCTCGAGAAATTGATGCCACTACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026028.1-1242s1c1
Sequence:CCGGGCGCTTACAGATAATGACAAACTCGAGTTTGTCATTATCTGTAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026028
VALIDATED
CCDC77 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 77
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000339837    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026028.4-1595s21c1
Sequence:CCGGCCAGAGTAGTGGCATCAATTTCTCGAGAAATTGATGCCACTACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026028.4-326s21c1
Sequence:CCGGGCATAAACTTGAGTGGAACTTCTCGAGAAGTTCCACTCAAGTTTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026028.4-982s21c1
Sequence:CCGGTGTCAAAGATTACGCAGTATACTCGAGTATACTGCGTAATCTTTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026028.4-132s21c1
Sequence:CCGGGATACCAACAGGTGGAAGAAACTCGAGTTTCTTCCACCTGTTGGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026028.1-313s1c1
Sequence:CCGGGCTTGCGAAGAGCAGCATAAACTCGAGTTTATGCTGCTCTTCGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026028.1-133s1c1
Sequence:CCGGGATACCAACAGGTGGAAGAAACTCGAGTTTCTTCCACCTGTTGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026028.1-327s1c1
Sequence:CCGGGCATAAACTTGAGTGGAACTTCTCGAGAAGTTCCACTCAAGTTTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198824    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026028.1-1596s1c1
Sequence:CCGGCCAGAGTAGTGGCATCAATTTCTCGAGAAATTGATGCCACTACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026028.1-1242s1c1
Sequence:CCGGGCGCTTACAGATAATGACAAACTCGAGTTTGTCATTATCTGTAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032358
CCDC77 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 77
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032358.2-1158s1c1
Sequence:CCGGCCAAGAGCAGTGCATTTCCTTCTCGAGAAGGAAATGCACTGCTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032358.2-1497s1c1
Sequence:CCGGGAAAGTGTTTGGTCTGGAGAACTCGAGTTCTCCAGACCAAACACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137629    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032358.2-1969s1c1
Sequence:CCGGGCACATCACAACCTGTCACATCTCGAGATGTGACAGGTTGTGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032358.2-703s1c1
Sequence:CCGGGAGCATTACCAAAGAGACATACTCGAGTATGTCTCTTTGGTAATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032358.2-1456s1c1
Sequence:CCGGCGGGCACATAAGATACAAGGACTCGAGTCCTTGTATCTTATGTGCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032358
CCDC77 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 77
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032358.2-1158s1c1
Sequence:CCGGCCAAGAGCAGTGCATTTCCTTCTCGAGAAGGAAATGCACTGCTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032358.2-1497s1c1
Sequence:CCGGGAAAGTGTTTGGTCTGGAGAACTCGAGTTCTCCAGACCAAACACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137629    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032358.2-1969s1c1
Sequence:CCGGGCACATCACAACCTGTCACATCTCGAGATGTGACAGGTTGTGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032358.2-703s1c1
Sequence:CCGGGAGCATTACCAAAGAGACATACTCGAGTATGTCTCTTTGGTAATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032358.2-1456s1c1
Sequence:CCGGCGGGCACATAAGATACAAGGACTCGAGTCCTTGTATCTTATGTGCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032358
CCDC77 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 77
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032358.2-1158s1c1
Sequence:CCGGCCAAGAGCAGTGCATTTCCTTCTCGAGAAGGAAATGCACTGCTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032358.2-1497s1c1
Sequence:CCGGGAAAGTGTTTGGTCTGGAGAACTCGAGTTCTCCAGACCAAACACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137629    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032358.2-1969s1c1
Sequence:CCGGGCACATCACAACCTGTCACATCTCGAGATGTGACAGGTTGTGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032358.2-703s1c1
Sequence:CCGGGAGCATTACCAAAGAGACATACTCGAGTATGTCTCTTTGGTAATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032358.2-1456s1c1
Sequence:CCGGCGGGCACATAAGATACAAGGACTCGAGTCCTTGTATCTTATGTGCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks