EMAIL THIS PAGE TO A FRIEND

CCDC78

coiled-coil domain containing 78

Synonyms: C16orf25 CNM4 JFP10
Gene ID:
Human(124093) Summary: The product of this gene contains two coiled-coil domains. The function of this gene is currently unknown. [provided by RefSeq, Sep 2012]
Mouse(381077) coiled-coil domain containing 78
Rat(302996) coiled-coil domain containing 78
Zebrafish(100150366) coiled-coil domain containing 78
chicken(769634) coiled-coil domain containing 78
cow(511835) coiled-coil domain containing 78
domestic cat(101091584) coiled-coil domain containing 78
dog(490088) coiled-coil domain containing 78
naked mole-rat(101706279) coiled-coil domain containing 78
domestic guinea pig(100721841) coiled-coil domain containing 78
sheep(101104626) coiled-coil domain containing 78
105 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173476 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173476 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173476 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001165929 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001165929 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001165929 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU098281 MISSION® esiRNA esiRNA human CCDC78 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001031737 Rosetta Predictions human pricing
NM_173476 Rosetta Predictions human pricing
XM_220252 Rosetta Predictions rat pricing
XR_007835 Rosetta Predictions rat pricing
XM_354998 Rosetta Predictions mouse pricing
XM_914813 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031737 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00092097 predicted 1075
2 SASI_Hs01_00092098 predicted 230
3 SASI_Hs02_00307794 predicted 229
4 SASI_Hs01_00092100 predicted 1332
5 SASI_Hs01_00092101 predicted 1328
6 SASI_Hs02_00307795 predicted 227
7 SASI_Hs01_00092102 predicted 998
8 SASI_Hs01_00092104 predicted 899
9 SASI_Hs01_00092105 predicted 194
10 SASI_Hs02_00307796 predicted 898
11 SASI_Hs01_00092099 predicted 1023
12 SASI_Hs01_00092103 predicted 866
13 SASI_Hs01_00092106 predicted 293
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173476 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121557 predicted 458
2 SASI_Hs01_00121558 predicted 738
3 SASI_Hs01_00121559 predicted 460
4 SASI_Hs01_00121560 predicted 241
5 SASI_Hs01_00121561 predicted 457
6 SASI_Hs01_00121562 predicted 469
7 SASI_Hs01_00121563 predicted 372
8 SASI_Hs01_00121564 predicted 294
9 SASI_Hs01_00121565 predicted 1018
10 SASI_Hs01_00121566 predicted 424
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_220252 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00187280 predicted 271
2 SASI_Rn01_00187281 predicted 477
3 SASI_Rn01_00187282 predicted 229
4 SASI_Rn01_00187283 predicted 372
5 SASI_Rn01_00187284 predicted 251
6 SASI_Rn01_00187285 predicted 252
7 SASI_Rn01_00187286 predicted 237
8 SASI_Rn01_00187287 predicted 370
9 SASI_Rn01_00187288 predicted 454
10 SASI_Rn01_00187289 predicted 229
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_007835 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00415585 predicted 694
2 SASI_Rn01_00128636 predicted 220
3 SASI_Rn01_00128637 predicted 365
4 SASI_Rn01_00128638 predicted 245
5 SASI_Rn01_00128639 predicted 247
6 SASI_Rn02_00415586 predicted 744
7 SASI_Rn02_00415587 predicted 670
8 SASI_Rn01_00128641 predicted 237
9 SASI_Rn01_00128642 predicted 360
10 SASI_Rn02_00415588 predicted 453
11 SASI_Rn01_00128633 predicted 271
12 SASI_Rn01_00128634 predicted 527
13 SASI_Rn01_00128635 predicted 475
14 SASI_Rn01_00128640 predicted 206
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_354998 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00223974 predicted 1024
2 SASI_Mm01_00223975 predicted 925
3 SASI_Mm01_00223977 predicted 386
4 SASI_Mm01_00223978 predicted 1129
5 SASI_Mm01_00223979 predicted 223
6 SASI_Mm01_00223980 predicted 205
7 SASI_Mm02_00425785 predicted 318
8 SASI_Mm01_00223981 predicted 900
9 SASI_Mm02_00425786 predicted 994
10 SASI_Mm02_00425787 predicted 252
11 SASI_Mm01_00223972 predicted 1552
12 SASI_Mm01_00223973 predicted 1536
13 SASI_Mm01_00223976 predicted 364
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_914813 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00438923 predicted 1022
2 SASI_Mm02_00438924 predicted 927
3 SASI_Mm02_00438925 predicted 383
4 SASI_Mm02_00438926 predicted 1134
5 SASI_Mm02_00438927 predicted 222
6 SASI_Mm02_00438928 predicted 206
7 SASI_Mm02_00438929 predicted 324
8 SASI_Mm02_00438930 predicted 901
9 SASI_Mm02_00438931 predicted 991
10 SASI_Mm02_00438932 predicted 251
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173476
CCDC78 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 78
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166324    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173476.2-727s1c1
Sequence:CCGGCTCTGATGACCACAGATTCCACTCGAGTGGAATCTGTGGTCATCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161432    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173476.2-2356s1c1
Sequence:CCGGGACACTGATAATCACAGGAAACTCGAGTTTCCTGTGATTATCAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163133    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173476.2-3221s1c1
Sequence:CCGGGCAAGTCACTTAAGCATGGTTCTCGAGAACCATGCTTAAGTGACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163293    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173476.2-557s1c1
Sequence:CCGGGAAATCTTCCAGCTGAAGAGTCTCGAGACTCTTCAGCTGGAAGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164004    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173476.2-2355s1c1
Sequence:CCGGCGACACTGATAATCACAGGAACTCGAGTTCCTGTGATTATCAGTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164101    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173476.2-3160s1c1
Sequence:CCGGCTGGTTGGAATGAAGGATGATCTCGAGATCATCCTTCATTCCAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164258    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173476.2-1299s1c1
Sequence:CCGGCAGCTCAAGAAACTGAAGGATCTCGAGATCCTTCAGTTTCTTGAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164671    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173476.2-514s1c1
Sequence:CCGGCATTCAGATCACAACCCACCACTCGAGTGGTGGGTTGTGATCTGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165558    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173476.2-2061s1c1
Sequence:CCGGGCCTTGTTCAGCCAACTGAAACTCGAGTTTCAGTTGGCTGAACAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165332    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173476.2-723s1c1
Sequence:CCGGGACACTCTGATGACCACAGATCTCGAGATCTGTGGTCATCAGAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173476
CCDC78 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 78
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166324    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173476.2-727s1c1
Sequence:CCGGCTCTGATGACCACAGATTCCACTCGAGTGGAATCTGTGGTCATCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161432    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173476.2-2356s1c1
Sequence:CCGGGACACTGATAATCACAGGAAACTCGAGTTTCCTGTGATTATCAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163133    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173476.2-3221s1c1
Sequence:CCGGGCAAGTCACTTAAGCATGGTTCTCGAGAACCATGCTTAAGTGACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163293    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173476.2-557s1c1
Sequence:CCGGGAAATCTTCCAGCTGAAGAGTCTCGAGACTCTTCAGCTGGAAGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164004    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173476.2-2355s1c1
Sequence:CCGGCGACACTGATAATCACAGGAACTCGAGTTCCTGTGATTATCAGTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164101    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173476.2-3160s1c1
Sequence:CCGGCTGGTTGGAATGAAGGATGATCTCGAGATCATCCTTCATTCCAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164258    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173476.2-1299s1c1
Sequence:CCGGCAGCTCAAGAAACTGAAGGATCTCGAGATCCTTCAGTTTCTTGAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164671    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173476.2-514s1c1
Sequence:CCGGCATTCAGATCACAACCCACCACTCGAGTGGTGGGTTGTGATCTGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165558    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173476.2-2061s1c1
Sequence:CCGGGCCTTGTTCAGCCAACTGAAACTCGAGTTTCAGTTGGCTGAACAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165332    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173476.2-723s1c1
Sequence:CCGGGACACTCTGATGACCACAGATCTCGAGATCTGTGGTCATCAGAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173476
CCDC78 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 78
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166324    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173476.2-727s1c1
Sequence:CCGGCTCTGATGACCACAGATTCCACTCGAGTGGAATCTGTGGTCATCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161432    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173476.2-2356s1c1
Sequence:CCGGGACACTGATAATCACAGGAAACTCGAGTTTCCTGTGATTATCAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163133    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173476.2-3221s1c1
Sequence:CCGGGCAAGTCACTTAAGCATGGTTCTCGAGAACCATGCTTAAGTGACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163293    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173476.2-557s1c1
Sequence:CCGGGAAATCTTCCAGCTGAAGAGTCTCGAGACTCTTCAGCTGGAAGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164004    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173476.2-2355s1c1
Sequence:CCGGCGACACTGATAATCACAGGAACTCGAGTTCCTGTGATTATCAGTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164101    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173476.2-3160s1c1
Sequence:CCGGCTGGTTGGAATGAAGGATGATCTCGAGATCATCCTTCATTCCAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164258    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173476.2-1299s1c1
Sequence:CCGGCAGCTCAAGAAACTGAAGGATCTCGAGATCCTTCAGTTTCTTGAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164671    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173476.2-514s1c1
Sequence:CCGGCATTCAGATCACAACCCACCACTCGAGTGGTGGGTTGTGATCTGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165558    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173476.2-2061s1c1
Sequence:CCGGGCCTTGTTCAGCCAACTGAAACTCGAGTTTCAGTTGGCTGAACAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165332    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173476.2-723s1c1
Sequence:CCGGGACACTCTGATGACCACAGATCTCGAGATCTGTGGTCATCAGAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001165929
CCDC78 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 78
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000452972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001165929.1-65s21c1
Sequence:CCGGCTATGGAGTATGTGGCATCTCCTCGAGGAGATGCCACATACTCCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000452646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001165929.1-788s21c1
Sequence:CCGGAGTCCACTCTGCAGGACATTACTCGAGTAATGTCCTGCAGAGTGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000440598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001165929.1-687s21c1
Sequence:CCGGGAAGATGAACGAGGAGTATGCCTCGAGGCATACTCCTCGTTCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000441089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001165929.1-1208s21c1
Sequence:CCGGTTTCTGAGCTACAGGAGTATGCTCGAGCATACTCCTGTAGCTCAGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000441580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001165929.1-391s21c1
Sequence:CCGGGGACATAAAGTCCAACCAATGCTCGAGCATTGGTTGGACTTTATGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000442172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001165929.1-1270s21c1
Sequence:CCGGCTGAGGAAGTTGGTGAATATTCTCGAGAATATTCACCAACTTCCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000444239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001165929.1-1008s21c1
Sequence:CCGGACATAGGACACTGCTACTGTACTCGAGTACAGTAGCAGTGTCCTATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001165929
CCDC78 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 78
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000452972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001165929.1-65s21c1
Sequence:CCGGCTATGGAGTATGTGGCATCTCCTCGAGGAGATGCCACATACTCCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000452646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001165929.1-788s21c1
Sequence:CCGGAGTCCACTCTGCAGGACATTACTCGAGTAATGTCCTGCAGAGTGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000440598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001165929.1-687s21c1
Sequence:CCGGGAAGATGAACGAGGAGTATGCCTCGAGGCATACTCCTCGTTCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000441089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001165929.1-1208s21c1
Sequence:CCGGTTTCTGAGCTACAGGAGTATGCTCGAGCATACTCCTGTAGCTCAGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000441580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001165929.1-391s21c1
Sequence:CCGGGGACATAAAGTCCAACCAATGCTCGAGCATTGGTTGGACTTTATGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000442172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001165929.1-1270s21c1
Sequence:CCGGCTGAGGAAGTTGGTGAATATTCTCGAGAATATTCACCAACTTCCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000444239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001165929.1-1008s21c1
Sequence:CCGGACATAGGACACTGCTACTGTACTCGAGTACAGTAGCAGTGTCCTATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001165929
CCDC78 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 78
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000452972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001165929.1-65s21c1
Sequence:CCGGCTATGGAGTATGTGGCATCTCCTCGAGGAGATGCCACATACTCCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000452646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001165929.1-788s21c1
Sequence:CCGGAGTCCACTCTGCAGGACATTACTCGAGTAATGTCCTGCAGAGTGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000440598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001165929.1-687s21c1
Sequence:CCGGGAAGATGAACGAGGAGTATGCCTCGAGGCATACTCCTCGTTCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000441089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001165929.1-1208s21c1
Sequence:CCGGTTTCTGAGCTACAGGAGTATGCTCGAGCATACTCCTGTAGCTCAGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000441580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001165929.1-391s21c1
Sequence:CCGGGGACATAAAGTCCAACCAATGCTCGAGCATTGGTTGGACTTTATGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000442172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001165929.1-1270s21c1
Sequence:CCGGCTGAGGAAGTTGGTGAATATTCTCGAGAATATTCACCAACTTCCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000444239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001165929.1-1008s21c1
Sequence:CCGGACATAGGACACTGCTACTGTACTCGAGTACAGTAGCAGTGTCCTATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks