EMAIL THIS PAGE TO A FRIEND

CCDC79

coiled-coil domain containing 79

73 Gene Product Result for
UniProtKB ID: Q8NA31, A0AUW1
Gene ID:
Mouse(320022) coiled-coil domain containing 79
Rat(307615) coiled-coil domain containing 79
sheep(101108678) coiled-coil domain containing 79
Domestic Rabbit(100342788) coiled-coil domain containing 79
domestic guinea pig(100726022) coiled-coil domain containing 79
naked mole-rat(101702984) coiled-coil domain containing 79
Zebrafish(559140) coiled-coil domain containing 79
chicken(769532) coiled-coil domain containing 79
cow(100295202) coiled-coil domain containing 79
Horse(100629543) coiled-coil domain containing 79
domestic cat(101086273) coiled-coil domain containing 79
dog(479692) coiled-coil domain containing 79
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173616 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173616 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173616 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_180958 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_180958 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_180958 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001130007 Rosetta Predictions human pricing
XM_001717087 Rosetta Predictions human pricing
XM_001717868 Rosetta Predictions human pricing
XM_001057094 Rosetta Predictions rat pricing
XM_226205 Rosetta Predictions rat pricing
NM_180958 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001130007 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00386835 predicted 990
2 SASI_Hs02_00386836 predicted 1339
3 SASI_Hs02_00386837 predicted 1737
4 SASI_Hs02_00386838 predicted 1282
5 SASI_Hs02_00386839 predicted 1722
6 SASI_Hs02_00386840 predicted 1812
7 SASI_Hs02_00386841 predicted 1824
8 SASI_Hs02_00386842 predicted 1937
9 SASI_Hs02_00386843 predicted 1421
10 SASI_Hs02_00386844 predicted 1594
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001717087 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00414908 predicted 991
2 SASI_Hs02_00414909 predicted 426
3 SASI_Hs02_00414910 predicted 298
4 SASI_Hs02_00414911 predicted 709
5 SASI_Hs02_00414912 predicted 1277
6 SASI_Hs02_00414913 predicted 1729
7 SASI_Hs02_00414914 predicted 1807
8 SASI_Hs02_00414915 predicted 1941
9 SASI_Hs02_00414916 predicted 545
10 SASI_Hs02_00414917 predicted 672
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001717868 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00420056 predicted 992
2 SASI_Hs02_00420057 predicted 426
3 SASI_Hs02_00420058 predicted 306
4 SASI_Hs02_00420059 predicted 709
5 SASI_Hs02_00420060 predicted 1280
6 SASI_Hs02_00420061 predicted 1721
7 SASI_Hs02_00420062 predicted 1812
8 SASI_Hs02_00420063 predicted 1945
9 SASI_Hs02_00420064 predicted 548
10 SASI_Hs02_00420065 predicted 673
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057094 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00285379 predicted 649
2 SASI_Rn02_00285380 predicted 616
3 SASI_Rn02_00285381 predicted 1029
4 SASI_Rn02_00285382 predicted 1453
5 SASI_Rn02_00285383 predicted 1405
6 SASI_Rn02_00285384 predicted 1133
7 SASI_Rn02_00285385 predicted 384
8 SASI_Rn02_00285386 predicted 1705
9 SASI_Rn02_00285387 predicted 864
10 SASI_Rn02_00285388 predicted 478
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_226205 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00383399 predicted 1192
2 SASI_Rn02_00383400 predicted 1444
3 SASI_Rn02_00383401 predicted 1227
4 SASI_Rn02_00383402 predicted 2220
5 SASI_Rn02_00383403 predicted 1649
6 SASI_Rn02_00383404 predicted 1451
7 SASI_Rn02_00383405 predicted 1407
8 SASI_Rn02_00383406 predicted 1133
9 SASI_Rn02_00383407 predicted 1709
10 SASI_Rn02_00383408 predicted 2242
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_180958 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00157087 predicted 1619
2 SASI_Mm01_00157088 predicted 460
3 SASI_Mm01_00157089 predicted 1010
4 SASI_Mm01_00157091 predicted 992
5 SASI_Mm01_00157092 predicted 366
6 SASI_Mm01_00157093 predicted 1391
7 SASI_Mm01_00157094 predicted 1658
8 SASI_Mm01_00157095 predicted 1893
9 SASI_Mm02_00349582 predicted 1042
10 SASI_Mm01_00157096 predicted 864
11 SASI_Mm01_00157090 predicted 2373
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173616
CCDC79 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 79
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000136762    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173616.1-1618s1c1
Sequence:CCGGCCGTTAAAGAGCGCAAATCCACTCGAGTGGATTTGCGCTCTTTAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173616.1-1603s1c1
Sequence:CCGGGACCAAATGAAGACACCGTTACTCGAGTAACGGTGTCTTCATTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135177    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173616.1-1885s1c1
Sequence:CCGGCCGAAACTTTAGCAAGCTCTTCTCGAGAAGAGCTTGCTAAAGTTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134141    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173616.1-1375s1c1
Sequence:CCGGCACAGAATAGAACAGCTTGAACTCGAGTTCAAGCTGTTCTATTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173616.1-470s1c1
Sequence:CCGGCAAGTGAACATAGCATGGTAACTCGAGTTACCATGCTATGTTCACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173616.1-910s1c1
Sequence:CCGGCCTGAGATAATTCGCCCTATTCTCGAGAATAGGGCGAATTATCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173616.1-874s1c1
Sequence:CCGGCCACATGCTAATGAATGGCTACTCGAGTAGCCATTCATTAGCATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173616
CCDC79 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 79
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000136762    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173616.1-1618s1c1
Sequence:CCGGCCGTTAAAGAGCGCAAATCCACTCGAGTGGATTTGCGCTCTTTAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173616.1-1603s1c1
Sequence:CCGGGACCAAATGAAGACACCGTTACTCGAGTAACGGTGTCTTCATTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135177    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173616.1-1885s1c1
Sequence:CCGGCCGAAACTTTAGCAAGCTCTTCTCGAGAAGAGCTTGCTAAAGTTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134141    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173616.1-1375s1c1
Sequence:CCGGCACAGAATAGAACAGCTTGAACTCGAGTTCAAGCTGTTCTATTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173616.1-470s1c1
Sequence:CCGGCAAGTGAACATAGCATGGTAACTCGAGTTACCATGCTATGTTCACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173616.1-910s1c1
Sequence:CCGGCCTGAGATAATTCGCCCTATTCTCGAGAATAGGGCGAATTATCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173616.1-874s1c1
Sequence:CCGGCCACATGCTAATGAATGGCTACTCGAGTAGCCATTCATTAGCATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173616
CCDC79 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 79
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000136762    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173616.1-1618s1c1
Sequence:CCGGCCGTTAAAGAGCGCAAATCCACTCGAGTGGATTTGCGCTCTTTAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173616.1-1603s1c1
Sequence:CCGGGACCAAATGAAGACACCGTTACTCGAGTAACGGTGTCTTCATTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135177    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173616.1-1885s1c1
Sequence:CCGGCCGAAACTTTAGCAAGCTCTTCTCGAGAAGAGCTTGCTAAAGTTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134141    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173616.1-1375s1c1
Sequence:CCGGCACAGAATAGAACAGCTTGAACTCGAGTTCAAGCTGTTCTATTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173616.1-470s1c1
Sequence:CCGGCAAGTGAACATAGCATGGTAACTCGAGTTACCATGCTATGTTCACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173616.1-910s1c1
Sequence:CCGGCCTGAGATAATTCGCCCTATTCTCGAGAATAGGGCGAATTATCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173616.1-874s1c1
Sequence:CCGGCCACATGCTAATGAATGGCTACTCGAGTAGCCATTCATTAGCATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_180958
CCDC79 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 79
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113325    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_180958.1-2540s1c1
Sequence:CCGGCGGTCCTTTGTTTGGACTCTTCTCGAGAAGAGTCCAAACAAAGGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_180958.1-1250s1c1
Sequence:CCGGCCATTGATGATACAAGCCTTACTCGAGTAAGGCTTGTATCATCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_180958.1-869s1c1
Sequence:CCGGCCTGAGGTAATTCGACCTATACTCGAGTATAGGTCGAATTACCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_180958.1-2166s1c1
Sequence:CCGGCCTGTAGAAGAAGACAACTTTCTCGAGAAAGTTGTCTTCTTCTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_180958.1-368s1c1
Sequence:CCGGGCAGGTATTTATTTCCGGGAACTCGAGTTCCCGGAAATAAATACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_180958
CCDC79 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 79
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113325    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_180958.1-2540s1c1
Sequence:CCGGCGGTCCTTTGTTTGGACTCTTCTCGAGAAGAGTCCAAACAAAGGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_180958.1-1250s1c1
Sequence:CCGGCCATTGATGATACAAGCCTTACTCGAGTAAGGCTTGTATCATCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_180958.1-869s1c1
Sequence:CCGGCCTGAGGTAATTCGACCTATACTCGAGTATAGGTCGAATTACCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_180958.1-2166s1c1
Sequence:CCGGCCTGTAGAAGAAGACAACTTTCTCGAGAAAGTTGTCTTCTTCTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_180958.1-368s1c1
Sequence:CCGGGCAGGTATTTATTTCCGGGAACTCGAGTTCCCGGAAATAAATACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_180958
CCDC79 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 79
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113325    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_180958.1-2540s1c1
Sequence:CCGGCGGTCCTTTGTTTGGACTCTTCTCGAGAAGAGTCCAAACAAAGGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_180958.1-1250s1c1
Sequence:CCGGCCATTGATGATACAAGCCTTACTCGAGTAAGGCTTGTATCATCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_180958.1-869s1c1
Sequence:CCGGCCTGAGGTAATTCGACCTATACTCGAGTATAGGTCGAATTACCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_180958.1-2166s1c1
Sequence:CCGGCCTGTAGAAGAAGACAACTTTCTCGAGAAAGTTGTCTTCTTCTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_180958.1-368s1c1
Sequence:CCGGGCAGGTATTTATTTCCGGGAACTCGAGTTCCCGGAAATAAATACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks