EMAIL THIS PAGE TO A FRIEND

CCDC7

coiled-coil domain containing 7

64 Gene Product Result for
Synonyms: BioT2-A BioT2-B BioT2-C RP11-479G22.1
UniProtKB ID: Q96M83, Q5VW55, Q8IVQ0, Q8NEQ0
Gene ID:
Mouse(74703) coiled-coil domain containing 7
Rat(497041) coiled-coil domain containing 7
domestic cat(101099728) coiled-coil domain containing 7
dog(477958) coiled-coil domain containing 7
cow(616662) coiled-coil domain containing 7
sheep(101111568) coiled-coil domain containing 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV54463 Anti-CCDC7 antibody produced in rabbit affinity isolated antibody human, mouse, bovine, rabbit, horse, rat
western blot pricing
SAB2700676 Anti-CCDC7 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145023 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145023 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145023 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029061 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029061 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029061 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU219791 MISSION® esiRNA esiRNA targeting human CCDC7 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001026383 Rosetta Predictions human pricing
NM_145023 Rosetta Predictions human pricing
NM_001011561 Rosetta Predictions rat pricing
NM_029061 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001026383 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00307507 predicted 923
2 SASI_Hs01_00154202 predicted 1640
3 SASI_Hs01_00154203 predicted 727
4 SASI_Hs01_00154204 predicted 729
5 SASI_Hs02_00307508 predicted 1150
6 SASI_Hs01_00154205 predicted 1333
7 SASI_Hs01_00154206 predicted 711
8 SASI_Hs01_00154207 predicted 740
9 SASI_Hs01_00154208 predicted 542
10 SASI_Hs01_00154209 predicted 1561
11 SASI_Hs01_00154201 predicted 1160
12 SASI_Hs01_00154210 predicted 973
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145023 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00364877 predicted 1162
2 SASI_Hs01_00195094 predicted 1878
3 SASI_Hs01_00195095 predicted 962
4 SASI_Hs01_00195096 predicted 958
5 SASI_Hs02_00364878 predicted 1381
6 SASI_Hs01_00195097 predicted 1570
7 SASI_Hs01_00195098 predicted 942
8 SASI_Hs01_00195099 predicted 980
9 SASI_Hs01_00195100 predicted 782
10 SASI_Hs01_00195101 predicted 1799
11 SASI_Hs01_00195093 predicted 1395
12 SASI_Hs01_00195102 predicted 1206
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011561 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00101765 predicted 480
2 SASI_Rn01_00101766 predicted 1053
3 SASI_Rn01_00101767 predicted 989
4 SASI_Rn01_00101768 predicted 1825
5 SASI_Rn01_00101769 predicted 1052
6 SASI_Rn01_00101770 predicted 1826
7 SASI_Rn02_00199847 predicted 1015
8 SASI_Rn01_00101771 predicted 1009
9 SASI_Rn01_00101772 predicted 1747
10 SASI_Rn01_00101774 predicted 435
11 SASI_Rn01_00101773 predicted 459
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029061 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00032953 predicted 445
2 SASI_Mm01_00032954 predicted 722
3 SASI_Mm01_00032955 predicted 812
4 SASI_Mm01_00032957 predicted 1076
5 SASI_Mm01_00032958 predicted 423
6 SASI_Mm02_00334795 predicted 875
7 SASI_Mm01_00032960 predicted 482
8 SASI_Mm01_00032961 predicted 393
9 SASI_Mm02_00334796 predicted 651
10 SASI_Mm01_00032962 predicted 1046
11 SASI_Mm01_00032956 predicted 924
12 SASI_Mm01_00032959 predicted 680
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145023
CCDC7 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 7
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130461    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145023.3-1117s1c1
Sequence:CCGGGAAGAACTGAAGAATCGCCTTCTCGAGAAGGCGATTCTTCAGTTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145023.3-997s1c1
Sequence:CCGGCAGGTCAATCAGATGGAAGAACTCGAGTTCTTCCATCTGATTGACCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145023.3-1087s1c1
Sequence:CCGGGCAGAAATAGTAAGGCTTGTACTCGAGTACAAGCCTTACTATTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128247    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145023.3-1309s1c1
Sequence:CCGGGCTCATTCAATGACTAATCGACTCGAGTCGATTAGTCATTGAATGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129676    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145023.3-743s1c1
Sequence:CCGGCAGAAGATGAAATGATCGGAACTCGAGTTCCGATCATTTCATCTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128807    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145023.3-710s1c1
Sequence:CCGGCCATTCCATCGAGTAAGACAACTCGAGTTGTCTTACTCGATGGAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129043    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145023.3-1782s1c1
Sequence:CCGGGACAACAATGCAAGTGGGTAACTCGAGTTACCCACTTGCATTGTTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145023.3-810s1c1
Sequence:CCGGCTATGGACATTGCGATCAGAACTCGAGTTCTGATCGCAATGTCCATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130087    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145023.3-1936s1c1
Sequence:CCGGCAAAGCGGAAGACTGATTGAACTCGAGTTCAATCAGTCTTCCGCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145023.3-1157s1c1
Sequence:CCGGCCGTGAAAGTCATGTTGTCTACTCGAGTAGACAACATGACTTTCACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145023.3-548s1c1
Sequence:CCGGCGGCAAATGTTCCAGCATTAACTCGAGTTAATGCTGGAACATTTGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145023
CCDC7 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 7
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130461    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145023.3-1117s1c1
Sequence:CCGGGAAGAACTGAAGAATCGCCTTCTCGAGAAGGCGATTCTTCAGTTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145023.3-997s1c1
Sequence:CCGGCAGGTCAATCAGATGGAAGAACTCGAGTTCTTCCATCTGATTGACCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145023.3-1087s1c1
Sequence:CCGGGCAGAAATAGTAAGGCTTGTACTCGAGTACAAGCCTTACTATTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128247    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145023.3-1309s1c1
Sequence:CCGGGCTCATTCAATGACTAATCGACTCGAGTCGATTAGTCATTGAATGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129676    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145023.3-743s1c1
Sequence:CCGGCAGAAGATGAAATGATCGGAACTCGAGTTCCGATCATTTCATCTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128807    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145023.3-710s1c1
Sequence:CCGGCCATTCCATCGAGTAAGACAACTCGAGTTGTCTTACTCGATGGAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129043    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145023.3-1782s1c1
Sequence:CCGGGACAACAATGCAAGTGGGTAACTCGAGTTACCCACTTGCATTGTTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145023.3-810s1c1
Sequence:CCGGCTATGGACATTGCGATCAGAACTCGAGTTCTGATCGCAATGTCCATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130087    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145023.3-1936s1c1
Sequence:CCGGCAAAGCGGAAGACTGATTGAACTCGAGTTCAATCAGTCTTCCGCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145023.3-1157s1c1
Sequence:CCGGCCGTGAAAGTCATGTTGTCTACTCGAGTAGACAACATGACTTTCACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145023.3-548s1c1
Sequence:CCGGCGGCAAATGTTCCAGCATTAACTCGAGTTAATGCTGGAACATTTGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145023
CCDC7 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 7
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130461    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145023.3-1117s1c1
Sequence:CCGGGAAGAACTGAAGAATCGCCTTCTCGAGAAGGCGATTCTTCAGTTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145023.3-997s1c1
Sequence:CCGGCAGGTCAATCAGATGGAAGAACTCGAGTTCTTCCATCTGATTGACCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145023.3-1087s1c1
Sequence:CCGGGCAGAAATAGTAAGGCTTGTACTCGAGTACAAGCCTTACTATTTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128247    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145023.3-1309s1c1
Sequence:CCGGGCTCATTCAATGACTAATCGACTCGAGTCGATTAGTCATTGAATGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129676    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145023.3-743s1c1
Sequence:CCGGCAGAAGATGAAATGATCGGAACTCGAGTTCCGATCATTTCATCTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128807    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145023.3-710s1c1
Sequence:CCGGCCATTCCATCGAGTAAGACAACTCGAGTTGTCTTACTCGATGGAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129043    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145023.3-1782s1c1
Sequence:CCGGGACAACAATGCAAGTGGGTAACTCGAGTTACCCACTTGCATTGTTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145023.3-810s1c1
Sequence:CCGGCTATGGACATTGCGATCAGAACTCGAGTTCTGATCGCAATGTCCATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130087    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145023.3-1936s1c1
Sequence:CCGGCAAAGCGGAAGACTGATTGAACTCGAGTTCAATCAGTCTTCCGCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145023.3-1157s1c1
Sequence:CCGGCCGTGAAAGTCATGTTGTCTACTCGAGTAGACAACATGACTTTCACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145023.3-548s1c1
Sequence:CCGGCGGCAAATGTTCCAGCATTAACTCGAGTTAATGCTGGAACATTTGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029061
CCDC7 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 7
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000201400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029061.1-680s1c1
Sequence:CCGGGCTTGCTATGATAATGGAGAACTCGAGTTCTCCATTATCATAGCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029061.1-926s1c1
Sequence:CCGGGCCAGTTTGAACATTGTACAACTCGAGTTGTACAATGTTCAAACTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029061.1-568s1c1
Sequence:CCGGCTTGCCAATACCATTGAGTAACTCGAGTTACTCAATGGTATTGGCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029061.1-1199s1c1
Sequence:CCGGCAGTCAACTATGTTAGAGAAACTCGAGTTTCTCTAACATAGTTGACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029061
CCDC7 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 7
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000201400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029061.1-680s1c1
Sequence:CCGGGCTTGCTATGATAATGGAGAACTCGAGTTCTCCATTATCATAGCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029061.1-926s1c1
Sequence:CCGGGCCAGTTTGAACATTGTACAACTCGAGTTGTACAATGTTCAAACTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029061.1-568s1c1
Sequence:CCGGCTTGCCAATACCATTGAGTAACTCGAGTTACTCAATGGTATTGGCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029061.1-1199s1c1
Sequence:CCGGCAGTCAACTATGTTAGAGAAACTCGAGTTTCTCTAACATAGTTGACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029061
CCDC7 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 7
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000201400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029061.1-680s1c1
Sequence:CCGGGCTTGCTATGATAATGGAGAACTCGAGTTCTCCATTATCATAGCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029061.1-926s1c1
Sequence:CCGGGCCAGTTTGAACATTGTACAACTCGAGTTGTACAATGTTCAAACTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029061.1-568s1c1
Sequence:CCGGCTTGCCAATACCATTGAGTAACTCGAGTTACTCAATGGTATTGGCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029061.1-1199s1c1
Sequence:CCGGCAGTCAACTATGTTAGAGAAACTCGAGTTTCTCTAACATAGTTGACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)