EMAIL THIS PAGE TO A FRIEND

CCDC80

coiled-coil domain containing 80

62 Gene Product Result for
Synonyms: DRO1 SSG1 URB okuribin
Gene ID:
Mouse(67896) coiled-coil domain containing 80
Rat(64387) coiled-coil domain containing 80
sheep(101122067) coiled-coil domain containing 80
Domestic Rabbit(100348411) coiled-coil domain containing 80
domestic guinea pig(100733036) coiled-coil domain containing 80
naked mole-rat(101726064) coiled-coil domain containing 80
Zebrafish(368419) coiled-coil domain containing 80
domestic cat(101089134) coiled-coil domain containing 80
cow(515235) coiled-coil domain containing 80
Horse(100061376) coiled-coil domain containing 80
dog(478566) coiled-coil domain containing 80
chicken(395074) coiled-coil domain containing 80
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026439 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026439 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026439 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_199511 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_199511 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_199511 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_199511 Rosetta Predictions human pricing
NM_199512 Rosetta Predictions human pricing
NM_022543 Rosetta Predictions rat pricing
NM_026439 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199511 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372887 predicted 3294
2 SASI_Hs01_00203765 predicted 2926
3 SASI_Hs01_00203767 predicted 3158
4 SASI_Hs01_00203768 predicted 3179
5 SASI_Hs02_00372888 predicted 3075
6 SASI_Hs02_00372889 predicted 3624
7 SASI_Hs01_00203769 predicted 3012
8 SASI_Hs01_00203771 predicted 3305
9 SASI_Hs01_00203772 predicted 3429
10 SASI_Hs01_00203774 predicted 3355
11 SASI_Hs01_00203766 predicted 1295
12 SASI_Hs01_00203770 predicted 2933
13 SASI_Hs01_00203773 predicted 1265
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199512 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372890 predicted 2692
2 SASI_Hs01_00160848 predicted 2332
3 SASI_Hs01_00160850 predicted 2558
4 SASI_Hs01_00160851 predicted 2573
5 SASI_Hs02_00372891 predicted 3032
6 SASI_Hs01_00160852 predicted 2417
7 SASI_Hs02_00372892 predicted 2398
8 SASI_Hs01_00160854 predicted 2710
9 SASI_Hs01_00160855 predicted 2837
10 SASI_Hs01_00160857 predicted 2762
11 SASI_Hs01_00160849 predicted 701
12 SASI_Hs01_00160853 predicted 2336
13 SASI_Hs01_00160856 predicted 662
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022543 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00263308 predicted 2589
2 SASI_Rn02_00263309 predicted 2881
3 SASI_Rn02_00263310 predicted 1074
4 SASI_Rn02_00263311 predicted 871
5 SASI_Rn02_00263312 predicted 3007
6 SASI_Rn02_00263313 predicted 3143
7 SASI_Rn02_00263314 predicted 2556
8 SASI_Rn02_00263315 predicted 627
9 SASI_Rn02_00263316 predicted 2380
10 SASI_Rn02_00263317 predicted 3024
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026439 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00128039 predicted 863
2 SASI_Mm01_00128041 predicted 2874
3 SASI_Mm02_00330267 predicted 1076
4 SASI_Mm02_00330268 predicted 3302
5 SASI_Mm01_00128043 predicted 3131
6 SASI_Mm01_00128044 predicted 2554
7 SASI_Mm01_00128045 predicted 780
8 SASI_Mm01_00128046 predicted 2369
9 SASI_Mm01_00128047 predicted 2596
10 SASI_Mm02_00330269 predicted 2492
11 SASI_Mm01_00128040 predicted 1787
12 SASI_Mm01_00128042 predicted 2891
13 SASI_Mm01_00128048 predicted 1770
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026439
VALIDATED
CCDC80 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 80
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026439.2-3032s21c1
Sequence:CCGGGGTCGATGGTCATCGTGTATGCTCGAGCATACACGATGACCATCGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216113    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026439.2-3387s1c1
Sequence:CCGGCTACTCATGACTTGTTATTAACTCGAGTTAATAACAAGTCATGAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026439.2-2866s21c1
Sequence:CCGGTTAGAACTGTTCCCAATTAATCTCGAGATTAATTGGGAACAGTTCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026439.2-3139s21c1
Sequence:CCGGGGATATGGTTACCATAGTTATCTCGAGATAACTATGGTAACCATATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026439.2-1961s21c1
Sequence:CCGGATAGCGTTCCCTCGCAGAATGCTCGAGCATTCTGCGAGGGAACGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246914    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026439.2-3387s21c1
Sequence:CCGGCTACTCATGACTTGTTATTAACTCGAGTTAATAACAAGTCATGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201395    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026439.1-2700s1c1
Sequence:CCGGGCGACATATAACCATTCTGAACTCGAGTTCAGAATGGTTATATGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201199    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026439.1-2818s1c1
Sequence:CCGGGTCAAAGATATCCGCAACTATCTCGAGATAGTTGCGGATATCTTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192368    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026439.1-3039s1c1
Sequence:CCGGCCATAGTTATCACCAAGGATACTCGAGTATCCTTGGTGATAACTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026439
VALIDATED
CCDC80 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 80
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026439.2-3032s21c1
Sequence:CCGGGGTCGATGGTCATCGTGTATGCTCGAGCATACACGATGACCATCGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216113    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026439.2-3387s1c1
Sequence:CCGGCTACTCATGACTTGTTATTAACTCGAGTTAATAACAAGTCATGAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026439.2-2866s21c1
Sequence:CCGGTTAGAACTGTTCCCAATTAATCTCGAGATTAATTGGGAACAGTTCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026439.2-3139s21c1
Sequence:CCGGGGATATGGTTACCATAGTTATCTCGAGATAACTATGGTAACCATATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026439.2-1961s21c1
Sequence:CCGGATAGCGTTCCCTCGCAGAATGCTCGAGCATTCTGCGAGGGAACGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246914    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026439.2-3387s21c1
Sequence:CCGGCTACTCATGACTTGTTATTAACTCGAGTTAATAACAAGTCATGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201395    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026439.1-2700s1c1
Sequence:CCGGGCGACATATAACCATTCTGAACTCGAGTTCAGAATGGTTATATGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201199    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026439.1-2818s1c1
Sequence:CCGGGTCAAAGATATCCGCAACTATCTCGAGATAGTTGCGGATATCTTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192368    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026439.1-3039s1c1
Sequence:CCGGCCATAGTTATCACCAAGGATACTCGAGTATCCTTGGTGATAACTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026439
VALIDATED
CCDC80 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 80
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026439.2-3032s21c1
Sequence:CCGGGGTCGATGGTCATCGTGTATGCTCGAGCATACACGATGACCATCGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216113    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026439.2-3387s1c1
Sequence:CCGGCTACTCATGACTTGTTATTAACTCGAGTTAATAACAAGTCATGAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026439.2-2866s21c1
Sequence:CCGGTTAGAACTGTTCCCAATTAATCTCGAGATTAATTGGGAACAGTTCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026439.2-3139s21c1
Sequence:CCGGGGATATGGTTACCATAGTTATCTCGAGATAACTATGGTAACCATATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026439.2-1961s21c1
Sequence:CCGGATAGCGTTCCCTCGCAGAATGCTCGAGCATTCTGCGAGGGAACGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246914    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026439.2-3387s21c1
Sequence:CCGGCTACTCATGACTTGTTATTAACTCGAGTTAATAACAAGTCATGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201395    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026439.1-2700s1c1
Sequence:CCGGGCGACATATAACCATTCTGAACTCGAGTTCAGAATGGTTATATGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201199    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026439.1-2818s1c1
Sequence:CCGGGTCAAAGATATCCGCAACTATCTCGAGATAGTTGCGGATATCTTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192368    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026439.1-3039s1c1
Sequence:CCGGCCATAGTTATCACCAAGGATACTCGAGTATCCTTGGTGATAACTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199511
VALIDATED
CCDC80 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 80
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000232645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_199511.1-3300s21c1
Sequence:CCGGTTAGAACTGTTCCCAATTAATCTCGAGATTAATTGGGAACAGTTCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232648    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199511.1-3937s21c1
Sequence:CCGGCTTATATGAAGGACCTTATTTCTCGAGAAATAAGGTCCTTCATATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_199511.1-3473s21c1
Sequence:CCGGGGTGATTGTGTACGATTTAATCTCGAGATTAAATCGTACACAATCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199511.1-3364s21c1
Sequence:CCGGTGAAAGACATTCGTAACTATTCTCGAGAATAGTTACGAATGTCTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_199511.1-2926s21c1
Sequence:CCGGAGTACGGAATGACCTACAATGCTCGAGCATTGTAGGTCATTCCGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199511.1-1469s1c1
Sequence:CCGGCATCCCTAAGCTGATGAGCTTCTCGAGAAGCTCATCAGCTTAGGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135898    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199511.1-4247s1c1
Sequence:CCGGGCTTTGTTATCATAGCCACTTCTCGAGAAGTGGCTATGATAACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199511.1-2516s1c1
Sequence:CCGGGCAAATGAAGAAGTCTGAGAACTCGAGTTCTCAGACTTCTTCATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199511.1-3050s1c1
Sequence:CCGGCCGAATCAAAGATATGGAGAACTCGAGTTCTCCATATCTTTGATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136666    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199511.1-3295s1c1
Sequence:CCGGGAGTGTTAGAACTGTTCCCAACTCGAGTTGGGAACAGTTCTAACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199511.1-2930s1c1
Sequence:CCGGCGGAATGACCTACAATGACTTCTCGAGAAGTCATTGTAGGTCATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137265    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199511.1-2925s1c1
Sequence:CCGGGAGTACGGAATGACCTACAATCTCGAGATTGTAGGTCATTCCGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199511
VALIDATED
CCDC80 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 80
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000232645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_199511.1-3300s21c1
Sequence:CCGGTTAGAACTGTTCCCAATTAATCTCGAGATTAATTGGGAACAGTTCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232648    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199511.1-3937s21c1
Sequence:CCGGCTTATATGAAGGACCTTATTTCTCGAGAAATAAGGTCCTTCATATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_199511.1-3473s21c1
Sequence:CCGGGGTGATTGTGTACGATTTAATCTCGAGATTAAATCGTACACAATCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199511.1-3364s21c1
Sequence:CCGGTGAAAGACATTCGTAACTATTCTCGAGAATAGTTACGAATGTCTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_199511.1-2926s21c1
Sequence:CCGGAGTACGGAATGACCTACAATGCTCGAGCATTGTAGGTCATTCCGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199511.1-1469s1c1
Sequence:CCGGCATCCCTAAGCTGATGAGCTTCTCGAGAAGCTCATCAGCTTAGGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135898    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199511.1-4247s1c1
Sequence:CCGGGCTTTGTTATCATAGCCACTTCTCGAGAAGTGGCTATGATAACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199511.1-2516s1c1
Sequence:CCGGGCAAATGAAGAAGTCTGAGAACTCGAGTTCTCAGACTTCTTCATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199511.1-3050s1c1
Sequence:CCGGCCGAATCAAAGATATGGAGAACTCGAGTTCTCCATATCTTTGATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136666    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199511.1-3295s1c1
Sequence:CCGGGAGTGTTAGAACTGTTCCCAACTCGAGTTGGGAACAGTTCTAACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199511.1-2930s1c1
Sequence:CCGGCGGAATGACCTACAATGACTTCTCGAGAAGTCATTGTAGGTCATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137265    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199511.1-2925s1c1
Sequence:CCGGGAGTACGGAATGACCTACAATCTCGAGATTGTAGGTCATTCCGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199511
VALIDATED
CCDC80 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 80
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000232645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_199511.1-3300s21c1
Sequence:CCGGTTAGAACTGTTCCCAATTAATCTCGAGATTAATTGGGAACAGTTCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232648    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199511.1-3937s21c1
Sequence:CCGGCTTATATGAAGGACCTTATTTCTCGAGAAATAAGGTCCTTCATATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_199511.1-3473s21c1
Sequence:CCGGGGTGATTGTGTACGATTTAATCTCGAGATTAAATCGTACACAATCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199511.1-3364s21c1
Sequence:CCGGTGAAAGACATTCGTAACTATTCTCGAGAATAGTTACGAATGTCTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_199511.1-2926s21c1
Sequence:CCGGAGTACGGAATGACCTACAATGCTCGAGCATTGTAGGTCATTCCGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199511.1-1469s1c1
Sequence:CCGGCATCCCTAAGCTGATGAGCTTCTCGAGAAGCTCATCAGCTTAGGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135898    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199511.1-4247s1c1
Sequence:CCGGGCTTTGTTATCATAGCCACTTCTCGAGAAGTGGCTATGATAACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199511.1-2516s1c1
Sequence:CCGGGCAAATGAAGAAGTCTGAGAACTCGAGTTCTCAGACTTCTTCATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199511.1-3050s1c1
Sequence:CCGGCCGAATCAAAGATATGGAGAACTCGAGTTCTCCATATCTTTGATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136666    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199511.1-3295s1c1
Sequence:CCGGGAGTGTTAGAACTGTTCCCAACTCGAGTTGGGAACAGTTCTAACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199511.1-2930s1c1
Sequence:CCGGCGGAATGACCTACAATGACTTCTCGAGAAGTCATTGTAGGTCATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137265    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199511.1-2925s1c1
Sequence:CCGGGAGTACGGAATGACCTACAATCTCGAGATTGTAGGTCATTCCGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks