EMAIL THIS PAGE TO A FRIEND

CCDC81

coiled-coil domain containing 81

UniProtKB ID: Q6ZN84, A0AVL7, Q53FW3, Q9H5E5
Gene ID:
Mouse(70884) coiled-coil domain containing 81
Rat(308810) coiled-coil domain containing 81
chicken(427311) coiled-coil domain containing 81
domestic cat(101082940) coiled-coil domain containing 81
cow(519195) coiled-coil domain containing 81
Horse(100061073) coiled-coil domain containing 81
dog(476777) coiled-coil domain containing 81
naked mole-rat(101703964) coiled-coil domain containing 81
domestic guinea pig(100728227) coiled-coil domain containing 81
sheep(101113447) coiled-coil domain containing 81
Domestic Rabbit(100343370) coiled-coil domain containing 81
67 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021827 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021827 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021827 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001162979 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001162979 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001162979 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU072081 MISSION® esiRNA esiRNA human CCDC81 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021827 Rosetta Predictions human pricing
NM_001014021 Rosetta Predictions rat pricing
XM_885490 Rosetta Predictions mouse pricing
XM_911668 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021827 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00028988 predicted 1208
2 SASI_Hs01_00028989 predicted 582
3 SASI_Hs01_00028990 predicted 1352
4 SASI_Hs01_00028992 predicted 2174
5 SASI_Hs01_00028993 predicted 1874
6 SASI_Hs01_00028994 predicted 1916
7 SASI_Hs01_00028995 predicted 1042
8 SASI_Hs01_00028996 predicted 671
9 SASI_Hs01_00028997 predicted 904
10 SASI_Hs02_00355142 predicted 1497
11 SASI_Hs01_00028991 predicted 688
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014021 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00055058 predicted 1326
2 SASI_Rn01_00055059 predicted 1045
3 SASI_Rn01_00055060 predicted 617
4 SASI_Rn01_00055061 predicted 1395
5 SASI_Rn02_00201403 predicted 1549
6 SASI_Rn01_00055062 predicted 1928
7 SASI_Rn01_00055064 predicted 850
8 SASI_Rn01_00055065 predicted 1444
9 SASI_Rn01_00055067 predicted 1667
10 SASI_Rn02_00201404 predicted 517
11 SASI_Rn01_00055063 predicted 418
12 SASI_Rn01_00055066 predicted 730
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_885490 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00267016 predicted 435
2 SASI_Mm01_00267017 predicted 697
3 SASI_Mm01_00267018 predicted 832
4 SASI_Mm01_00267020 predicted 1235
5 SASI_Mm01_00267021 predicted 931
6 SASI_Mm02_00428222 predicted 1266
7 SASI_Mm01_00267022 predicted 1060
8 SASI_Mm01_00267023 predicted 1124
9 SASI_Mm01_00267024 predicted 1417
10 SASI_Mm01_00267025 predicted 873
11 SASI_Mm01_00267019 predicted 1113
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_911668 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00436535 predicted 1759
2 SASI_Mm02_00436536 predicted 1709
3 SASI_Mm02_00436537 predicted 433
4 SASI_Mm02_00436538 predicted 700
5 SASI_Mm02_00436539 predicted 824
6 SASI_Mm02_00436540 predicted 2296
7 SASI_Mm02_00436541 predicted 1236
8 SASI_Mm02_00436542 predicted 2264
9 SASI_Mm02_00436543 predicted 935
10 SASI_Mm02_00436544 predicted 1415
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021827
CCDC81 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 81
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021827.1-1133s1c1
Sequence:CCGGGAGGACACAAAGAGAGCACTTCTCGAGAAGTGCTCTCTTTGTGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021827.1-406s1c1
Sequence:CCGGCCAAAGTGACAAATGTCAGCTCTCGAGAGCTGACATTTGTCACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021827.1-503s1c1
Sequence:CCGGGAAACACGACAGTGAGATGAACTCGAGTTCATCTCACTGTCGTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021827.1-884s1c1
Sequence:CCGGGATGGAAGAAACACAGTGTTACTCGAGTAACACTGTGTTTCTTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021827.1-353s1c1
Sequence:CCGGCAGAGATATCTCATCACCCAACTCGAGTTGGGTGATGAGATATCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021827.4-1554s21c1
Sequence:CCGGGCTGCGCAAAGAGCGAAATTTCTCGAGAAATTTCGCTCTTTGCGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021827.4-539s21c1
Sequence:CCGGATTTGTGAGACGGCAGTTAACCTCGAGGTTAACTGCCGTCTCACAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428561    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021827.4-2178s21c1
Sequence:CCGGTGATTGTGAAACTGCGTATTTCTCGAGAAATACGCAGTTTCACAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021827.4-1147s21c1
Sequence:CCGGTGCAACGAGCACAACGAAATTCTCGAGAATTTCGTTGTGCTCGTTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021827
CCDC81 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 81
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021827.1-1133s1c1
Sequence:CCGGGAGGACACAAAGAGAGCACTTCTCGAGAAGTGCTCTCTTTGTGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021827.1-406s1c1
Sequence:CCGGCCAAAGTGACAAATGTCAGCTCTCGAGAGCTGACATTTGTCACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021827.1-503s1c1
Sequence:CCGGGAAACACGACAGTGAGATGAACTCGAGTTCATCTCACTGTCGTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021827.1-884s1c1
Sequence:CCGGGATGGAAGAAACACAGTGTTACTCGAGTAACACTGTGTTTCTTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021827.1-353s1c1
Sequence:CCGGCAGAGATATCTCATCACCCAACTCGAGTTGGGTGATGAGATATCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021827.4-1554s21c1
Sequence:CCGGGCTGCGCAAAGAGCGAAATTTCTCGAGAAATTTCGCTCTTTGCGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021827.4-539s21c1
Sequence:CCGGATTTGTGAGACGGCAGTTAACCTCGAGGTTAACTGCCGTCTCACAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428561    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021827.4-2178s21c1
Sequence:CCGGTGATTGTGAAACTGCGTATTTCTCGAGAAATACGCAGTTTCACAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021827.4-1147s21c1
Sequence:CCGGTGCAACGAGCACAACGAAATTCTCGAGAATTTCGTTGTGCTCGTTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021827
CCDC81 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 81
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021827.1-1133s1c1
Sequence:CCGGGAGGACACAAAGAGAGCACTTCTCGAGAAGTGCTCTCTTTGTGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021827.1-406s1c1
Sequence:CCGGCCAAAGTGACAAATGTCAGCTCTCGAGAGCTGACATTTGTCACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021827.1-503s1c1
Sequence:CCGGGAAACACGACAGTGAGATGAACTCGAGTTCATCTCACTGTCGTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021827.1-884s1c1
Sequence:CCGGGATGGAAGAAACACAGTGTTACTCGAGTAACACTGTGTTTCTTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021827.1-353s1c1
Sequence:CCGGCAGAGATATCTCATCACCCAACTCGAGTTGGGTGATGAGATATCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021827.4-1554s21c1
Sequence:CCGGGCTGCGCAAAGAGCGAAATTTCTCGAGAAATTTCGCTCTTTGCGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021827.4-539s21c1
Sequence:CCGGATTTGTGAGACGGCAGTTAACCTCGAGGTTAACTGCCGTCTCACAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428561    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021827.4-2178s21c1
Sequence:CCGGTGATTGTGAAACTGCGTATTTCTCGAGAAATACGCAGTTTCACAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021827.4-1147s21c1
Sequence:CCGGTGCAACGAGCACAACGAAATTCTCGAGAATTTCGTTGTGCTCGTTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001162979
CCDC81 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 81
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000341655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162979.1-1363s21c1
Sequence:CCGGCAACGAGCACAACGGAATTTCCTCGAGGAAATTCCGTTGTGCTCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341588    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001162979.1-2338s21c1
Sequence:CCGGTCAACGCTTGAACCTACTATTCTCGAGAATAGTAGGTTCAAGCGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162979.1-1419s21c1
Sequence:CCGGGATTGAAGATGAGCGACTTATCTCGAGATAAGTCGCTCATCTTCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162979.1-704s21c1
Sequence:CCGGTATCCCTGGAGGGTCCATTTACTCGAGTAAATGGACCCTCCAGGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162979.1-587s21c1
Sequence:CCGGTAGTGCAGAGGCCGGTGTTTACTCGAGTAAACACCGGCCTCTGCACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001162979
CCDC81 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 81
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000341655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162979.1-1363s21c1
Sequence:CCGGCAACGAGCACAACGGAATTTCCTCGAGGAAATTCCGTTGTGCTCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341588    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001162979.1-2338s21c1
Sequence:CCGGTCAACGCTTGAACCTACTATTCTCGAGAATAGTAGGTTCAAGCGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162979.1-1419s21c1
Sequence:CCGGGATTGAAGATGAGCGACTTATCTCGAGATAAGTCGCTCATCTTCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162979.1-704s21c1
Sequence:CCGGTATCCCTGGAGGGTCCATTTACTCGAGTAAATGGACCCTCCAGGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162979.1-587s21c1
Sequence:CCGGTAGTGCAGAGGCCGGTGTTTACTCGAGTAAACACCGGCCTCTGCACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001162979
CCDC81 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 81
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000341655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162979.1-1363s21c1
Sequence:CCGGCAACGAGCACAACGGAATTTCCTCGAGGAAATTCCGTTGTGCTCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341588    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001162979.1-2338s21c1
Sequence:CCGGTCAACGCTTGAACCTACTATTCTCGAGAATAGTAGGTTCAAGCGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162979.1-1419s21c1
Sequence:CCGGGATTGAAGATGAGCGACTTATCTCGAGATAAGTCGCTCATCTTCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162979.1-704s21c1
Sequence:CCGGTATCCCTGGAGGGTCCATTTACTCGAGTAAATGGACCCTCCAGGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162979.1-587s21c1
Sequence:CCGGTAGTGCAGAGGCCGGTGTTTACTCGAGTAAACACCGGCCTCTGCACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks