EMAIL THIS PAGE TO A FRIEND

CCDC82

coiled-coil domain containing 82

96 Gene Product Result for
Synonyms: HSPC048
UniProtKB ID: Q8N4S0, B3KPU7, Q8WV71, Q9H2Q5, Q9H5E3
Gene ID:
Mouse(66396) coiled-coil domain containing 82
Rat(300359) coiled-coil domain containing 82
sheep(101123145) coiled-coil domain containing 82
domestic guinea pig(100723834) coiled-coil domain containing 82
naked mole-rat(101721650) coiled-coil domain containing 82
Zebrafish(327538) coiled-coil domain containing 82
cow(511627) coiled-coil domain containing 82
Horse(100061101) coiled-coil domain containing 82
domestic cat(101100912) coiled-coil domain containing 82
dog(485114) coiled-coil domain containing 82
chicken(426136) coiled-coil domain containing 82
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024725 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024725 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024725 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025534 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025534 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025534 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024725 Rosetta Predictions human pricing
NM_001007660 Rosetta Predictions rat pricing
NM_025534 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024725 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00357195 predicted 1440
2 SASI_Hs01_00067365 predicted 1780
3 SASI_Hs01_00067366 predicted 1052
4 SASI_Hs01_00067367 predicted 1410
5 SASI_Hs01_00067368 predicted 564
6 SASI_Hs01_00067369 predicted 1168
7 SASI_Hs01_00067370 predicted 1324
8 SASI_Hs02_00357196 predicted 1630
9 SASI_Hs01_00067373 predicted 1353
10 SASI_Hs01_00067374 predicted 1606
11 SASI_Hs01_00067371 predicted 1494
12 SASI_Hs01_00067372 predicted 482
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007660 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00082671 predicted 605
2 SASI_Rn02_00198786 predicted 449
3 SASI_Rn01_00082672 predicted 1372
4 SASI_Rn01_00082673 predicted 349
5 SASI_Rn01_00082674 predicted 866
6 SASI_Rn01_00082675 predicted 325
7 SASI_Rn01_00082676 predicted 1188
8 SASI_Rn01_00082677 predicted 1053
9 SASI_Rn01_00082678 predicted 842
10 SASI_Rn01_00082679 predicted 263
11 SASI_Rn01_00082670 predicted 1187
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025534 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00081937 predicted 643
2 SASI_Mm01_00081938 predicted 1572
3 SASI_Mm01_00081939 predicted 444
4 SASI_Mm01_00081940 predicted 487
5 SASI_Mm01_00081941 predicted 420
6 SASI_Mm01_00081942 predicted 1286
7 SASI_Mm01_00081943 predicted 1232
8 SASI_Mm01_00081944 predicted 1618
9 SASI_Mm01_00081945 predicted 1263
10 SASI_Mm01_00081946 predicted 1518
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024725
CCDC82 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 82
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024725.3-284s21c1
Sequence:CCGGGTTGATTGGAGGCGAACTAAACTCGAGTTTAGTTCGCCTCCAATCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024725.3-976s21c1
Sequence:CCGGACGCAGTAGTGGTAGAGATTTCTCGAGAAATCTCTACCACTACTGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024725.3-456s21c1
Sequence:CCGGGTGAAAGAGAGCTCAACTTAACTCGAGTTAAGTTGAGCTCTCTTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130855    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024725.2-2120s1c1
Sequence:CCGGGCTGTTGATATCCTGTCAGTTCTCGAGAACTGACAGGATATCAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129823    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024725.2-2109s1c1
Sequence:CCGGCAAGTGAATGAGCTGTTGATACTCGAGTATCAACAGCTCATTCACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128006    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024725.2-2427s1c1
Sequence:CCGGGAGTCTTTCAACCCTCACATTCTCGAGAATGTGAGGGTTGAAAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024725.2-1539s1c1
Sequence:CCGGCCAGGACCATGCAAATAGATACTCGAGTATCTATTTGCATGGTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024725.2-326s1c1
Sequence:CCGGGAAGAGCTTGATAGTGAAGAACTCGAGTTCTTCACTATCAAGCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024725.2-1611s1c1
Sequence:CCGGGCCGTACCAGAATTTATCATACTCGAGTATGATAAATTCTGGTACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024725.2-404s1c1
Sequence:CCGGGATAGTAACAAGGGACCTGATCTCGAGATCAGGTCCCTTGTTACTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129929    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024725.2-356s1c1
Sequence:CCGGGATGAAGAGCTTGATAGTGATCTCGAGATCACTATCAAGCTCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024725
CCDC82 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 82
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024725.3-284s21c1
Sequence:CCGGGTTGATTGGAGGCGAACTAAACTCGAGTTTAGTTCGCCTCCAATCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024725.3-976s21c1
Sequence:CCGGACGCAGTAGTGGTAGAGATTTCTCGAGAAATCTCTACCACTACTGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024725.3-456s21c1
Sequence:CCGGGTGAAAGAGAGCTCAACTTAACTCGAGTTAAGTTGAGCTCTCTTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130855    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024725.2-2120s1c1
Sequence:CCGGGCTGTTGATATCCTGTCAGTTCTCGAGAACTGACAGGATATCAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129823    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024725.2-2109s1c1
Sequence:CCGGCAAGTGAATGAGCTGTTGATACTCGAGTATCAACAGCTCATTCACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128006    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024725.2-2427s1c1
Sequence:CCGGGAGTCTTTCAACCCTCACATTCTCGAGAATGTGAGGGTTGAAAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024725.2-1539s1c1
Sequence:CCGGCCAGGACCATGCAAATAGATACTCGAGTATCTATTTGCATGGTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024725.2-326s1c1
Sequence:CCGGGAAGAGCTTGATAGTGAAGAACTCGAGTTCTTCACTATCAAGCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024725.2-1611s1c1
Sequence:CCGGGCCGTACCAGAATTTATCATACTCGAGTATGATAAATTCTGGTACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024725.2-404s1c1
Sequence:CCGGGATAGTAACAAGGGACCTGATCTCGAGATCAGGTCCCTTGTTACTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129929    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024725.2-356s1c1
Sequence:CCGGGATGAAGAGCTTGATAGTGATCTCGAGATCACTATCAAGCTCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024725
CCDC82 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 82
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024725.3-284s21c1
Sequence:CCGGGTTGATTGGAGGCGAACTAAACTCGAGTTTAGTTCGCCTCCAATCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024725.3-976s21c1
Sequence:CCGGACGCAGTAGTGGTAGAGATTTCTCGAGAAATCTCTACCACTACTGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024725.3-456s21c1
Sequence:CCGGGTGAAAGAGAGCTCAACTTAACTCGAGTTAAGTTGAGCTCTCTTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130855    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024725.2-2120s1c1
Sequence:CCGGGCTGTTGATATCCTGTCAGTTCTCGAGAACTGACAGGATATCAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129823    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024725.2-2109s1c1
Sequence:CCGGCAAGTGAATGAGCTGTTGATACTCGAGTATCAACAGCTCATTCACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128006    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024725.2-2427s1c1
Sequence:CCGGGAGTCTTTCAACCCTCACATTCTCGAGAATGTGAGGGTTGAAAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024725.2-1539s1c1
Sequence:CCGGCCAGGACCATGCAAATAGATACTCGAGTATCTATTTGCATGGTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024725.2-326s1c1
Sequence:CCGGGAAGAGCTTGATAGTGAAGAACTCGAGTTCTTCACTATCAAGCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024725.2-1611s1c1
Sequence:CCGGGCCGTACCAGAATTTATCATACTCGAGTATGATAAATTCTGGTACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024725.2-404s1c1
Sequence:CCGGGATAGTAACAAGGGACCTGATCTCGAGATCAGGTCCCTTGTTACTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129929    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024725.2-356s1c1
Sequence:CCGGGATGAAGAGCTTGATAGTGATCTCGAGATCACTATCAAGCTCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025534
VALIDATED
CCDC82 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 82
Mouse
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025534.2-422s21c1
Sequence:CCGGGAAGCAACAGTAAACATCTTACTCGAGTAAGATGTTTACTGTTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025534.2-472s21c1
Sequence:CCGGGAACAACTGAAGGAAACCAAACTCGAGTTTGGTTTCCTTCAGTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336232    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025534.2-2071s21c1
Sequence:CCGGGTACTTGTCTTACGAACATAACTCGAGTTATGTTCGTAAGACAAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025534.2-907s21c1
Sequence:CCGGGACGAGGATGATTACAGATATCTCGAGATATCTGTAATCATCCTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198304    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025534.1-432s1c1
Sequence:CCGGGCAGAGAATCATCACAACAGACTCGAGTCTGTTGTGATGATTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198231    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025534.1-550s1c1
Sequence:CCGGGCGATGACAGTGATATCCTAACTCGAGTTAGGATATCACTGTCATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197687    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025534.1-136s1c1
Sequence:CCGGGCATCTCACAGTTATTTGATACTCGAGTATCAAATAACTGTGAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197377    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025534.1-608s1c1
Sequence:CCGGCGAGGATGAATGTTCTTCATTCTCGAGAATGAAGAACATTCATCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025534.1-168s1c1
Sequence:CCGGCTAGATAGTAATGAGGAACTTCTCGAGAAGTTCCTCATTACTATCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197747    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025534.1-888s1c1
Sequence:CCGGGACGAGAATAGCAATCAACAACTCGAGTTGTTGATTGCTATTCTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025534.1-807s1c1
Sequence:CCGGGACGAGGATGATTACAGATATCTCGAGATATCTGTAATCATCCTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177032    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025534.1-243s1c1
Sequence:CCGGGATATTAGCAAGAAGTCTGATCTCGAGATCAGACTTCTTGCTAATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025534.1-322s1c1
Sequence:CCGGGAAGCAACAGTAAACATCTTACTCGAGTAAGATGTTTACTGTTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025534.1-393s1c1
Sequence:CCGGCATAATGACTTACCAGATGATCTCGAGATCATCTGGTAAGTCATTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025534.1-372s1c1
Sequence:CCGGGAACAACTGAAGGAAACCAAACTCGAGTTTGGTTTCCTTCAGTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025534.1-216s1c1
Sequence:CCGGGAAAGTATTGACAGTGATGAACTCGAGTTCATCACTGTCAATACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025534
VALIDATED
CCDC82 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 82
Mouse
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025534.2-422s21c1
Sequence:CCGGGAAGCAACAGTAAACATCTTACTCGAGTAAGATGTTTACTGTTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025534.2-472s21c1
Sequence:CCGGGAACAACTGAAGGAAACCAAACTCGAGTTTGGTTTCCTTCAGTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336232    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025534.2-2071s21c1
Sequence:CCGGGTACTTGTCTTACGAACATAACTCGAGTTATGTTCGTAAGACAAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025534.2-907s21c1
Sequence:CCGGGACGAGGATGATTACAGATATCTCGAGATATCTGTAATCATCCTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198304    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025534.1-432s1c1
Sequence:CCGGGCAGAGAATCATCACAACAGACTCGAGTCTGTTGTGATGATTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198231    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025534.1-550s1c1
Sequence:CCGGGCGATGACAGTGATATCCTAACTCGAGTTAGGATATCACTGTCATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197687    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025534.1-136s1c1
Sequence:CCGGGCATCTCACAGTTATTTGATACTCGAGTATCAAATAACTGTGAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197377    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025534.1-608s1c1
Sequence:CCGGCGAGGATGAATGTTCTTCATTCTCGAGAATGAAGAACATTCATCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025534.1-168s1c1
Sequence:CCGGCTAGATAGTAATGAGGAACTTCTCGAGAAGTTCCTCATTACTATCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197747    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025534.1-888s1c1
Sequence:CCGGGACGAGAATAGCAATCAACAACTCGAGTTGTTGATTGCTATTCTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025534.1-807s1c1
Sequence:CCGGGACGAGGATGATTACAGATATCTCGAGATATCTGTAATCATCCTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177032    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025534.1-243s1c1
Sequence:CCGGGATATTAGCAAGAAGTCTGATCTCGAGATCAGACTTCTTGCTAATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025534.1-322s1c1
Sequence:CCGGGAAGCAACAGTAAACATCTTACTCGAGTAAGATGTTTACTGTTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025534.1-393s1c1
Sequence:CCGGCATAATGACTTACCAGATGATCTCGAGATCATCTGGTAAGTCATTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025534.1-372s1c1
Sequence:CCGGGAACAACTGAAGGAAACCAAACTCGAGTTTGGTTTCCTTCAGTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025534.1-216s1c1
Sequence:CCGGGAAAGTATTGACAGTGATGAACTCGAGTTCATCACTGTCAATACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025534
VALIDATED
CCDC82 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 82
Mouse
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025534.2-422s21c1
Sequence:CCGGGAAGCAACAGTAAACATCTTACTCGAGTAAGATGTTTACTGTTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025534.2-472s21c1
Sequence:CCGGGAACAACTGAAGGAAACCAAACTCGAGTTTGGTTTCCTTCAGTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336232    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025534.2-2071s21c1
Sequence:CCGGGTACTTGTCTTACGAACATAACTCGAGTTATGTTCGTAAGACAAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025534.2-907s21c1
Sequence:CCGGGACGAGGATGATTACAGATATCTCGAGATATCTGTAATCATCCTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198304    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025534.1-432s1c1
Sequence:CCGGGCAGAGAATCATCACAACAGACTCGAGTCTGTTGTGATGATTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198231    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025534.1-550s1c1
Sequence:CCGGGCGATGACAGTGATATCCTAACTCGAGTTAGGATATCACTGTCATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197687    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025534.1-136s1c1
Sequence:CCGGGCATCTCACAGTTATTTGATACTCGAGTATCAAATAACTGTGAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197377    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025534.1-608s1c1
Sequence:CCGGCGAGGATGAATGTTCTTCATTCTCGAGAATGAAGAACATTCATCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025534.1-168s1c1
Sequence:CCGGCTAGATAGTAATGAGGAACTTCTCGAGAAGTTCCTCATTACTATCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197747    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025534.1-888s1c1
Sequence:CCGGGACGAGAATAGCAATCAACAACTCGAGTTGTTGATTGCTATTCTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025534.1-807s1c1
Sequence:CCGGGACGAGGATGATTACAGATATCTCGAGATATCTGTAATCATCCTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177032    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025534.1-243s1c1
Sequence:CCGGGATATTAGCAAGAAGTCTGATCTCGAGATCAGACTTCTTGCTAATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025534.1-322s1c1
Sequence:CCGGGAAGCAACAGTAAACATCTTACTCGAGTAAGATGTTTACTGTTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025534.1-393s1c1
Sequence:CCGGCATAATGACTTACCAGATGATCTCGAGATCATCTGGTAAGTCATTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025534.1-372s1c1
Sequence:CCGGGAACAACTGAAGGAAACCAAACTCGAGTTTGGTTTCCTTCAGTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025534.1-216s1c1
Sequence:CCGGGAAAGTATTGACAGTGATGAACTCGAGTTCATCACTGTCAATACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks