EMAIL THIS PAGE TO A FRIEND

CCDC83

coiled-coil domain containing 83

48 Gene Product Result for
UniProtKB ID: Q8IWF9, B2RA49, Q6X7T2, Q6ZVT5, Q8N9Y1
Gene ID:
Mouse(75338) coiled-coil domain containing 83
Rat(680270) coiled-coil domain containing 83
Zebrafish(100004068) coiled-coil domain containing 83
domestic cat(101095677) coiled-coil domain containing 83
cow(617342) coiled-coil domain containing 83
dog(476781) coiled-coil domain containing 83
chicken(425232) coiled-coil domain containing 83
naked mole-rat(101707822) coiled-coil domain containing 83
domestic guinea pig(100729345) coiled-coil domain containing 83
sheep(101103433) coiled-coil domain containing 83
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029256 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029256 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029256 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_173556 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173556 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173556 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU069841 MISSION® esiRNA esiRNA human CCDC83 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173556 Rosetta Predictions human pricing
NM_029256 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173556 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00174816 predicted 1580
2 SASI_Hs01_00174817 predicted 1760
3 SASI_Hs02_00368369 predicted 1531
4 SASI_Hs02_00368370 predicted 721
5 SASI_Hs01_00174818 predicted 1905
6 SASI_Hs01_00174819 predicted 1635
7 SASI_Hs01_00174820 predicted 1425
8 SASI_Hs01_00174821 predicted 1278
9 SASI_Hs01_00174823 predicted 1062
10 SASI_Hs01_00174825 predicted 1573
11 SASI_Hs01_00174822 predicted 1490
12 SASI_Hs01_00174824 predicted 1112
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029256 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00335026 predicted 732
2 SASI_Mm01_00102267 predicted 685
3 SASI_Mm01_00102264 predicted 1024
4 SASI_Mm01_00102265 predicted 462
5 SASI_Mm01_00102266 predicted 871
6 SASI_Mm01_00102269 predicted 885
7 SASI_Mm01_00102270 predicted 329
8 SASI_Mm01_00102271 predicted 755
9 SASI_Mm01_00102272 predicted 460
10 SASI_Mm01_00102273 predicted 216
11 SASI_Mm01_00102268 predicted 1025
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029256
CCDC83 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 83
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029256.1-802s1c1
Sequence:CCGGGAAGGTGACACAGCATCCTTTCTCGAGAAAGGATGCTGTGTCACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029256.1-217s1c1
Sequence:CCGGCTGGACTATCATCGTGAAATACTCGAGTATTTCACGATGATAGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029256.1-756s1c1
Sequence:CCGGCAAGAACAACTATCGAGAGATCTCGAGATCTCTCGATAGTTGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029256.1-691s1c1
Sequence:CCGGGAAACAATGATCCAACTGAAACTCGAGTTTCAGTTGGATCATTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198892    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029256.1-1019s1c1
Sequence:CCGGGACAAACAAACAGCATGGCTACTCGAGTAGCCATGCTGTTTGTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198733    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029256.1-982s1c1
Sequence:CCGGCCTGATCCAGTCTGCATAATACTCGAGTATTATGCAGACTGGATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198668    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029256.1-1094s1c1
Sequence:CCGGCCCTCACATCTGTACAAGAAACTCGAGTTTCTTGTACAGATGTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029256.3-572s21c1
Sequence:CCGGGCACGCTCAACTCATTGTTTCCTCGAGGAAACAATGAGTTGAGCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216643    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029256.3-1225s1c1
Sequence:CCGGCATTGTCTTGGTTGGAATAACCTCGAGGTTATTCCAACCAAGACAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412812    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029256.3-1224s21c1
Sequence:CCGGTCATTGTCTTGGTTGGAATAACTCGAGTTATTCCAACCAAGACAATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029256.3-252s21c1
Sequence:CCGGGAGCGATTCATGTTCCATATCCTCGAGGATATGGAACATGAATCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029256.3-493s21c1
Sequence:CCGGATGAGGCTGAGAAGCTATTTCCTCGAGGAAATAGCTTCTCAGCCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029256.3-601s21c1
Sequence:CCGGATGACATCGACACAGTTAAAGCTCGAGCTTTAACTGTGTCGATGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029256.3-982s21c1
Sequence:CCGGCTGATCCAGTCTGCATAATATCTCGAGATATTATGCAGACTGGATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029256
CCDC83 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 83
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029256.1-802s1c1
Sequence:CCGGGAAGGTGACACAGCATCCTTTCTCGAGAAAGGATGCTGTGTCACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029256.1-217s1c1
Sequence:CCGGCTGGACTATCATCGTGAAATACTCGAGTATTTCACGATGATAGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029256.1-756s1c1
Sequence:CCGGCAAGAACAACTATCGAGAGATCTCGAGATCTCTCGATAGTTGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029256.1-691s1c1
Sequence:CCGGGAAACAATGATCCAACTGAAACTCGAGTTTCAGTTGGATCATTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198892    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029256.1-1019s1c1
Sequence:CCGGGACAAACAAACAGCATGGCTACTCGAGTAGCCATGCTGTTTGTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198733    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029256.1-982s1c1
Sequence:CCGGCCTGATCCAGTCTGCATAATACTCGAGTATTATGCAGACTGGATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198668    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029256.1-1094s1c1
Sequence:CCGGCCCTCACATCTGTACAAGAAACTCGAGTTTCTTGTACAGATGTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029256.3-572s21c1
Sequence:CCGGGCACGCTCAACTCATTGTTTCCTCGAGGAAACAATGAGTTGAGCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216643    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029256.3-1225s1c1
Sequence:CCGGCATTGTCTTGGTTGGAATAACCTCGAGGTTATTCCAACCAAGACAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412812    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029256.3-1224s21c1
Sequence:CCGGTCATTGTCTTGGTTGGAATAACTCGAGTTATTCCAACCAAGACAATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029256.3-252s21c1
Sequence:CCGGGAGCGATTCATGTTCCATATCCTCGAGGATATGGAACATGAATCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029256.3-493s21c1
Sequence:CCGGATGAGGCTGAGAAGCTATTTCCTCGAGGAAATAGCTTCTCAGCCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029256.3-601s21c1
Sequence:CCGGATGACATCGACACAGTTAAAGCTCGAGCTTTAACTGTGTCGATGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029256.3-982s21c1
Sequence:CCGGCTGATCCAGTCTGCATAATATCTCGAGATATTATGCAGACTGGATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029256
CCDC83 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 83
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029256.1-802s1c1
Sequence:CCGGGAAGGTGACACAGCATCCTTTCTCGAGAAAGGATGCTGTGTCACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029256.1-217s1c1
Sequence:CCGGCTGGACTATCATCGTGAAATACTCGAGTATTTCACGATGATAGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029256.1-756s1c1
Sequence:CCGGCAAGAACAACTATCGAGAGATCTCGAGATCTCTCGATAGTTGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029256.1-691s1c1
Sequence:CCGGGAAACAATGATCCAACTGAAACTCGAGTTTCAGTTGGATCATTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198892    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029256.1-1019s1c1
Sequence:CCGGGACAAACAAACAGCATGGCTACTCGAGTAGCCATGCTGTTTGTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198733    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029256.1-982s1c1
Sequence:CCGGCCTGATCCAGTCTGCATAATACTCGAGTATTATGCAGACTGGATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198668    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029256.1-1094s1c1
Sequence:CCGGCCCTCACATCTGTACAAGAAACTCGAGTTTCTTGTACAGATGTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029256.3-572s21c1
Sequence:CCGGGCACGCTCAACTCATTGTTTCCTCGAGGAAACAATGAGTTGAGCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216643    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029256.3-1225s1c1
Sequence:CCGGCATTGTCTTGGTTGGAATAACCTCGAGGTTATTCCAACCAAGACAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412812    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029256.3-1224s21c1
Sequence:CCGGTCATTGTCTTGGTTGGAATAACTCGAGTTATTCCAACCAAGACAATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029256.3-252s21c1
Sequence:CCGGGAGCGATTCATGTTCCATATCCTCGAGGATATGGAACATGAATCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029256.3-493s21c1
Sequence:CCGGATGAGGCTGAGAAGCTATTTCCTCGAGGAAATAGCTTCTCAGCCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029256.3-601s21c1
Sequence:CCGGATGACATCGACACAGTTAAAGCTCGAGCTTTAACTGTGTCGATGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029256.3-982s21c1
Sequence:CCGGCTGATCCAGTCTGCATAATATCTCGAGATATTATGCAGACTGGATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173556
CCDC83 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 83
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173556.2-1128s1c1
Sequence:CCGGGCTCATTGACAAGGGCAGTTACTCGAGTAACTGCCCTTGTCAATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136689    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173556.2-2076s1c1
Sequence:CCGGGAAGCATGACAGTGGGTTCAACTCGAGTTGAACCCACTGTCATGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133679    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173556.2-781s1c1
Sequence:CCGGGTAACAAGAGAGGATGTTGAACTCGAGTTCAACATCCTCTCTTGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134705    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173556.2-778s1c1
Sequence:CCGGGTTGTAACAAGAGAGGATGTTCTCGAGAACATCCTCTCTTGTTACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173556.2-1362s1c1
Sequence:CCGGGCCTTTGGAATCATGTCTAATCTCGAGATTAGACATGATTCCAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173556.2-685s1c1
Sequence:CCGGCATGAAAGAAATAGCCGCTTACTCGAGTAAGCGGCTATTTCTTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173556.2-1533s1c1
Sequence:CCGGCTCATCAGATGAGAGCACTATCTCGAGATAGTGCTCTCATCTGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135500    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173556.2-1857s1c1
Sequence:CCGGGCTGCAAAGGAAACACAACTTCTCGAGAAGTTGTGTTTCCTTTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173556.2-1189s1c1
Sequence:CCGGGCAATTCACAGGAAGGAAGTTCTCGAGAACTTCCTTCCTGTGAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173556
CCDC83 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 83
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173556.2-1128s1c1
Sequence:CCGGGCTCATTGACAAGGGCAGTTACTCGAGTAACTGCCCTTGTCAATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136689    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173556.2-2076s1c1
Sequence:CCGGGAAGCATGACAGTGGGTTCAACTCGAGTTGAACCCACTGTCATGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133679    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173556.2-781s1c1
Sequence:CCGGGTAACAAGAGAGGATGTTGAACTCGAGTTCAACATCCTCTCTTGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134705    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173556.2-778s1c1
Sequence:CCGGGTTGTAACAAGAGAGGATGTTCTCGAGAACATCCTCTCTTGTTACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173556.2-1362s1c1
Sequence:CCGGGCCTTTGGAATCATGTCTAATCTCGAGATTAGACATGATTCCAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173556.2-685s1c1
Sequence:CCGGCATGAAAGAAATAGCCGCTTACTCGAGTAAGCGGCTATTTCTTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173556.2-1533s1c1
Sequence:CCGGCTCATCAGATGAGAGCACTATCTCGAGATAGTGCTCTCATCTGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135500    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173556.2-1857s1c1
Sequence:CCGGGCTGCAAAGGAAACACAACTTCTCGAGAAGTTGTGTTTCCTTTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173556.2-1189s1c1
Sequence:CCGGGCAATTCACAGGAAGGAAGTTCTCGAGAACTTCCTTCCTGTGAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173556
CCDC83 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 83
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173556.2-1128s1c1
Sequence:CCGGGCTCATTGACAAGGGCAGTTACTCGAGTAACTGCCCTTGTCAATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136689    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173556.2-2076s1c1
Sequence:CCGGGAAGCATGACAGTGGGTTCAACTCGAGTTGAACCCACTGTCATGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133679    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173556.2-781s1c1
Sequence:CCGGGTAACAAGAGAGGATGTTGAACTCGAGTTCAACATCCTCTCTTGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134705    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173556.2-778s1c1
Sequence:CCGGGTTGTAACAAGAGAGGATGTTCTCGAGAACATCCTCTCTTGTTACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173556.2-1362s1c1
Sequence:CCGGGCCTTTGGAATCATGTCTAATCTCGAGATTAGACATGATTCCAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173556.2-685s1c1
Sequence:CCGGCATGAAAGAAATAGCCGCTTACTCGAGTAAGCGGCTATTTCTTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173556.2-1533s1c1
Sequence:CCGGCTCATCAGATGAGAGCACTATCTCGAGATAGTGCTCTCATCTGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135500    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173556.2-1857s1c1
Sequence:CCGGGCTGCAAAGGAAACACAACTTCTCGAGAAGTTGTGTTTCCTTTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173556.2-1189s1c1
Sequence:CCGGGCAATTCACAGGAAGGAAGTTCTCGAGAACTTCCTTCCTGTGAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks