EMAIL THIS PAGE TO A FRIEND

CCDC84

coiled-coil domain containing 84

50 Gene Product Result for
UniProtKB ID: Q86UT8
Gene ID:
Mouse(382073) coiled-coil domain containing 84
Rat(689046) coiled-coil domain containing 84
sheep(101104854) coiled-coil domain containing 84
domestic guinea pig(100722910) coiled-coil domain containing 84
naked mole-rat(101726681) coiled-coil domain containing 84
Zebrafish(767736) coiled-coil domain containing 84
cow(512413) coiled-coil domain containing 84
cow(785267) coiled-coil domain containing 84
dog(610660) coiled-coil domain containing 84
domestic cat(101093886) coiled-coil domain containing 84
chicken(419787) coiled-coil domain containing 84
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198489 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198489 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198489 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_201372 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_201372 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_201372 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU004961 MISSION® esiRNA esiRNA targeting human CCDC84 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198489 Rosetta Predictions human pricing
XM_001060013 Rosetta Predictions rat pricing
NM_201372 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198489 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372052 predicted 829
2 SASI_Hs02_00372053 predicted 780
3 SASI_Hs01_00219562 predicted 544
4 SASI_Hs01_00219564 predicted 827
5 SASI_Hs02_00372054 predicted 783
6 SASI_Hs02_00372055 predicted 589
7 SASI_Hs01_00219565 predicted 722
8 SASI_Hs01_00219566 predicted 700
9 SASI_Hs01_00219568 predicted 504
10 SASI_Hs01_00219571 predicted 601
11 SASI_Hs01_00219563 predicted 652
12 SASI_Hs01_00219567 predicted 835
13 SASI_Hs01_00219569 predicted 241
14 SASI_Hs01_00219570 predicted 717
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060013 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00295092 predicted 793
2 SASI_Rn02_00295093 predicted 701
3 SASI_Rn02_00295094 predicted 387
4 SASI_Rn02_00295095 predicted 314
5 SASI_Rn02_00295096 predicted 843
6 SASI_Rn02_00295097 predicted 609
7 SASI_Rn02_00295098 predicted 918
8 SASI_Rn02_00295099 predicted 435
9 SASI_Rn02_00295100 predicted 395
10 SASI_Rn02_00295101 predicted 499
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201372 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00197685 predicted 315
2 SASI_Mm01_00197686 predicted 627
3 SASI_Mm01_00197687 predicted 595
4 SASI_Mm01_00197688 predicted 473
5 SASI_Mm01_00197689 predicted 701
6 SASI_Mm01_00197690 predicted 386
7 SASI_Mm02_00351547 predicted 665
8 SASI_Mm01_00197691 predicted 611
9 SASI_Mm01_00197692 predicted 472
10 SASI_Mm02_00351548 predicted 688
11 SASI_Mm01_00197684 predicted 674
12 SASI_Mm01_00197693 predicted 926
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198489
VALIDATED
CCDC84 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 84
Human
25 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198489.1-596s21c1
Sequence:CCGGGGGCTCTTCAGCACCTAGAAGCTCGAGCTTCTAGGTGCTGAAGAGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198489.1-279s21c1
Sequence:CCGGGAACACCTGAGCCATGGAAACCTCGAGGTTTCCATGGCTCAGGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198489.1-547s21c1
Sequence:CCGGAGGTGGTTCGGTCTGTCTTAGCTCGAGCTAAGACAGACCGAACCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198489.1-751s21c1
Sequence:CCGGGAGTTGGTAACATCCACTCAGCTCGAGCTGAGTGGATGTTACCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198489.1-484s21c1
Sequence:CCGGAGGAGGATAAAGTGATCAAGGCTCGAGCCTTGATCACTTTATCCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198489.1-500s21c1
Sequence:CCGGCAAGGAGATGGCAGCTCAGATCTCGAGATCTGAGCTGCCATCTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198489.1-638s21c1
Sequence:CCGGAGTAGCTTCCAGCTTACAGCACTCGAGTGCTGTAAGCTGGAAGCTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198489.1-397s21c1
Sequence:CCGGAGATGAAAGAGAAGTTTCTGGCTCGAGCCAGAAACTTCTCTTTCATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198489.1-382s21c1
Sequence:CCGGACAAAGCTGAGGTCCAGATGACTCGAGTCATCTGGACCTCAGCTTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198489.1-713s21c1
Sequence:CCGGACCATCTCTGACATTCATTGGCTCGAGCCAATGAATGTCAGAGATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198489.1-986s1c1
Sequence:CCGGGCAGTCCAGACATCAATTCAACTCGAGTTGAATTGATGTCTGGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198489.1-437s1c1
Sequence:CCGGGCGATTCAAGAAATCCATGGTCTCGAGACCATGGATTTCTTGAATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142088    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198489.1-362s1c1
Sequence:CCGGCAACAAATTCTGGTGGGAGAACTCGAGTTCTCCCACCAGAATTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141708    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198489.1-821s1c1
Sequence:CCGGCCAAGAAATAGGACCATCCTACTCGAGTAGGATGGTCCTATTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141451    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198489.1-451s1c1
Sequence:CCGGCCATGGTGAAAGGTTTGGATTCTCGAGAATCCAAACCTTTCACCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140926    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198489.1-361s1c1
Sequence:CCGGCCAACAAATTCTGGTGGGAGACTCGAGTCTCCCACCAGAATTTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_198489.1-1017s1c1
Sequence:CCGGGCAGCAATGAAGAAGCAGTCACTCGAGTGACTGCTTCTTCATTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142042    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198489.1-1020s1c1
Sequence:CCGGGCAATGAAGAAGCAGTCACATCTCGAGATGTGACTGCTTCTTCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198489.1-907s1c1
Sequence:CCGGCCAACTTTGATCACAGCTCCACTCGAGTGGAGCTGTGATCAAAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139724    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198489.1-734s1c1
Sequence:CCGGCCATCAGGATATACCAGGAGTCTCGAGACTCCTGGTATATCCTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139860    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198489.1-783s1c1
Sequence:CCGGCCCTGGATGATCCAAGATGAACTCGAGTTCATCTTGGATCATCCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140219    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198489.1-813s1c1
Sequence:CCGGGCTGGGAACCAAGAAATAGGACTCGAGTCCTATTTCTTGGTTCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140387    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198489.1-620s1c1
Sequence:CCGGGAAAGGGATGAACAGCCAAGTCTCGAGACTTGGCTGTTCATCCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198489.1-804s1c1
Sequence:CCGGGAATACATTGCTGGGAACCAACTCGAGTTGGTTCCCAGCAATGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198489.1-347s1c1
Sequence:CCGGGCACAAGAAAGCAACCAACAACTCGAGTTGTTGGTTGCTTTCTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198489
VALIDATED
CCDC84 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 84
Human
25 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198489.1-596s21c1
Sequence:CCGGGGGCTCTTCAGCACCTAGAAGCTCGAGCTTCTAGGTGCTGAAGAGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198489.1-279s21c1
Sequence:CCGGGAACACCTGAGCCATGGAAACCTCGAGGTTTCCATGGCTCAGGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198489.1-547s21c1
Sequence:CCGGAGGTGGTTCGGTCTGTCTTAGCTCGAGCTAAGACAGACCGAACCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198489.1-751s21c1
Sequence:CCGGGAGTTGGTAACATCCACTCAGCTCGAGCTGAGTGGATGTTACCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198489.1-484s21c1
Sequence:CCGGAGGAGGATAAAGTGATCAAGGCTCGAGCCTTGATCACTTTATCCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198489.1-500s21c1
Sequence:CCGGCAAGGAGATGGCAGCTCAGATCTCGAGATCTGAGCTGCCATCTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198489.1-638s21c1
Sequence:CCGGAGTAGCTTCCAGCTTACAGCACTCGAGTGCTGTAAGCTGGAAGCTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198489.1-397s21c1
Sequence:CCGGAGATGAAAGAGAAGTTTCTGGCTCGAGCCAGAAACTTCTCTTTCATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198489.1-382s21c1
Sequence:CCGGACAAAGCTGAGGTCCAGATGACTCGAGTCATCTGGACCTCAGCTTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198489.1-713s21c1
Sequence:CCGGACCATCTCTGACATTCATTGGCTCGAGCCAATGAATGTCAGAGATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198489.1-986s1c1
Sequence:CCGGGCAGTCCAGACATCAATTCAACTCGAGTTGAATTGATGTCTGGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198489.1-437s1c1
Sequence:CCGGGCGATTCAAGAAATCCATGGTCTCGAGACCATGGATTTCTTGAATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142088    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198489.1-362s1c1
Sequence:CCGGCAACAAATTCTGGTGGGAGAACTCGAGTTCTCCCACCAGAATTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141708    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198489.1-821s1c1
Sequence:CCGGCCAAGAAATAGGACCATCCTACTCGAGTAGGATGGTCCTATTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141451    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198489.1-451s1c1
Sequence:CCGGCCATGGTGAAAGGTTTGGATTCTCGAGAATCCAAACCTTTCACCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140926    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198489.1-361s1c1
Sequence:CCGGCCAACAAATTCTGGTGGGAGACTCGAGTCTCCCACCAGAATTTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_198489.1-1017s1c1
Sequence:CCGGGCAGCAATGAAGAAGCAGTCACTCGAGTGACTGCTTCTTCATTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142042    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198489.1-1020s1c1
Sequence:CCGGGCAATGAAGAAGCAGTCACATCTCGAGATGTGACTGCTTCTTCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198489.1-907s1c1
Sequence:CCGGCCAACTTTGATCACAGCTCCACTCGAGTGGAGCTGTGATCAAAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139724    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198489.1-734s1c1
Sequence:CCGGCCATCAGGATATACCAGGAGTCTCGAGACTCCTGGTATATCCTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139860    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198489.1-783s1c1
Sequence:CCGGCCCTGGATGATCCAAGATGAACTCGAGTTCATCTTGGATCATCCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140219    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198489.1-813s1c1
Sequence:CCGGGCTGGGAACCAAGAAATAGGACTCGAGTCCTATTTCTTGGTTCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140387    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198489.1-620s1c1
Sequence:CCGGGAAAGGGATGAACAGCCAAGTCTCGAGACTTGGCTGTTCATCCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198489.1-804s1c1
Sequence:CCGGGAATACATTGCTGGGAACCAACTCGAGTTGGTTCCCAGCAATGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198489.1-347s1c1
Sequence:CCGGGCACAAGAAAGCAACCAACAACTCGAGTTGTTGGTTGCTTTCTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198489
VALIDATED
CCDC84 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 84
Human
25 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198489.1-596s21c1
Sequence:CCGGGGGCTCTTCAGCACCTAGAAGCTCGAGCTTCTAGGTGCTGAAGAGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198489.1-279s21c1
Sequence:CCGGGAACACCTGAGCCATGGAAACCTCGAGGTTTCCATGGCTCAGGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198489.1-547s21c1
Sequence:CCGGAGGTGGTTCGGTCTGTCTTAGCTCGAGCTAAGACAGACCGAACCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198489.1-751s21c1
Sequence:CCGGGAGTTGGTAACATCCACTCAGCTCGAGCTGAGTGGATGTTACCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198489.1-484s21c1
Sequence:CCGGAGGAGGATAAAGTGATCAAGGCTCGAGCCTTGATCACTTTATCCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198489.1-500s21c1
Sequence:CCGGCAAGGAGATGGCAGCTCAGATCTCGAGATCTGAGCTGCCATCTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198489.1-638s21c1
Sequence:CCGGAGTAGCTTCCAGCTTACAGCACTCGAGTGCTGTAAGCTGGAAGCTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198489.1-397s21c1
Sequence:CCGGAGATGAAAGAGAAGTTTCTGGCTCGAGCCAGAAACTTCTCTTTCATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198489.1-382s21c1
Sequence:CCGGACAAAGCTGAGGTCCAGATGACTCGAGTCATCTGGACCTCAGCTTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198489.1-713s21c1
Sequence:CCGGACCATCTCTGACATTCATTGGCTCGAGCCAATGAATGTCAGAGATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198489.1-986s1c1
Sequence:CCGGGCAGTCCAGACATCAATTCAACTCGAGTTGAATTGATGTCTGGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198489.1-437s1c1
Sequence:CCGGGCGATTCAAGAAATCCATGGTCTCGAGACCATGGATTTCTTGAATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142088    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198489.1-362s1c1
Sequence:CCGGCAACAAATTCTGGTGGGAGAACTCGAGTTCTCCCACCAGAATTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141708    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198489.1-821s1c1
Sequence:CCGGCCAAGAAATAGGACCATCCTACTCGAGTAGGATGGTCCTATTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141451    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198489.1-451s1c1
Sequence:CCGGCCATGGTGAAAGGTTTGGATTCTCGAGAATCCAAACCTTTCACCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140926    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198489.1-361s1c1
Sequence:CCGGCCAACAAATTCTGGTGGGAGACTCGAGTCTCCCACCAGAATTTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_198489.1-1017s1c1
Sequence:CCGGGCAGCAATGAAGAAGCAGTCACTCGAGTGACTGCTTCTTCATTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142042    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198489.1-1020s1c1
Sequence:CCGGGCAATGAAGAAGCAGTCACATCTCGAGATGTGACTGCTTCTTCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198489.1-907s1c1
Sequence:CCGGCCAACTTTGATCACAGCTCCACTCGAGTGGAGCTGTGATCAAAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139724    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198489.1-734s1c1
Sequence:CCGGCCATCAGGATATACCAGGAGTCTCGAGACTCCTGGTATATCCTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139860    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198489.1-783s1c1
Sequence:CCGGCCCTGGATGATCCAAGATGAACTCGAGTTCATCTTGGATCATCCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140219    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198489.1-813s1c1
Sequence:CCGGGCTGGGAACCAAGAAATAGGACTCGAGTCCTATTTCTTGGTTCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140387    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198489.1-620s1c1
Sequence:CCGGGAAAGGGATGAACAGCCAAGTCTCGAGACTTGGCTGTTCATCCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198489.1-804s1c1
Sequence:CCGGGAATACATTGCTGGGAACCAACTCGAGTTGGTTCCCAGCAATGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198489.1-347s1c1
Sequence:CCGGGCACAAGAAAGCAACCAACAACTCGAGTTGTTGGTTGCTTTCTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_201372
VALIDATED
CCDC84 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 84
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_201372.3-671s21c1
Sequence:CCGGACAGGACAGCAACTAACATTCCTCGAGGAATGTTAGTTGCTGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_201372.3-389s21c1
Sequence:CCGGCAGGATTATGCACGGTTTAAGCTCGAGCTTAAACCGTGCATAATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_201372.3-447s21c1
Sequence:CCGGAGGAGGACGAGGTGATTAAAGCTCGAGCTTTAATCACCTCGTCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_201372.3-708s21c1
Sequence:CCGGCACCCGGAATTGGTAACATTCCTCGAGGAATGTTACCAATTCCGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_201372.3-946s21c1
Sequence:CCGGCTGGCAGTCCAGGCATCAATTCTCGAGAATTGATGCCTGGACTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198563    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201372.1-441s1c1
Sequence:CCGGGCTTGGATTCCTATGAGGAAACTCGAGTTTCCTCATAGGAATCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182862    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201372.1-402s1c1
Sequence:CCGGCCCAGGATTATGCACGGTTTACTCGAGTAAACCGTGCATAATCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182073    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201372.1-343s1c1
Sequence:CCGGCAAATTCTGGTGGGAGAACAACTCGAGTTGTTCTCCCACCAGAATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181697    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201372.1-403s1c1
Sequence:CCGGCCAGGATTATGCACGGTTTAACTCGAGTTAAACCGTGCATAATCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181525    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201372.1-470s1c1
Sequence:CCGGGAGGTGATTAAAGAGATGGCACTCGAGTGCCATCTCTTTAATCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181786    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201372.1-371s1c1
Sequence:CCGGGCCCAGATGAAAGAGAAGTTTCTCGAGAAACTTCTCTTTCATCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182433    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201372.1-530s1c1
Sequence:CCGGGTCCGATCTGTCTTAGAGGTTCTCGAGAACCTCTAAGACAGATCGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_201372
VALIDATED
CCDC84 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 84
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_201372.3-671s21c1
Sequence:CCGGACAGGACAGCAACTAACATTCCTCGAGGAATGTTAGTTGCTGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_201372.3-389s21c1
Sequence:CCGGCAGGATTATGCACGGTTTAAGCTCGAGCTTAAACCGTGCATAATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_201372.3-447s21c1
Sequence:CCGGAGGAGGACGAGGTGATTAAAGCTCGAGCTTTAATCACCTCGTCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_201372.3-708s21c1
Sequence:CCGGCACCCGGAATTGGTAACATTCCTCGAGGAATGTTACCAATTCCGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_201372.3-946s21c1
Sequence:CCGGCTGGCAGTCCAGGCATCAATTCTCGAGAATTGATGCCTGGACTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198563    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201372.1-441s1c1
Sequence:CCGGGCTTGGATTCCTATGAGGAAACTCGAGTTTCCTCATAGGAATCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182862    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201372.1-402s1c1
Sequence:CCGGCCCAGGATTATGCACGGTTTACTCGAGTAAACCGTGCATAATCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182073    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201372.1-343s1c1
Sequence:CCGGCAAATTCTGGTGGGAGAACAACTCGAGTTGTTCTCCCACCAGAATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181697    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201372.1-403s1c1
Sequence:CCGGCCAGGATTATGCACGGTTTAACTCGAGTTAAACCGTGCATAATCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181525    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201372.1-470s1c1
Sequence:CCGGGAGGTGATTAAAGAGATGGCACTCGAGTGCCATCTCTTTAATCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181786    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201372.1-371s1c1
Sequence:CCGGGCCCAGATGAAAGAGAAGTTTCTCGAGAAACTTCTCTTTCATCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182433    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201372.1-530s1c1
Sequence:CCGGGTCCGATCTGTCTTAGAGGTTCTCGAGAACCTCTAAGACAGATCGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_201372
VALIDATED
CCDC84 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 84
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_201372.3-671s21c1
Sequence:CCGGACAGGACAGCAACTAACATTCCTCGAGGAATGTTAGTTGCTGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_201372.3-389s21c1
Sequence:CCGGCAGGATTATGCACGGTTTAAGCTCGAGCTTAAACCGTGCATAATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_201372.3-447s21c1
Sequence:CCGGAGGAGGACGAGGTGATTAAAGCTCGAGCTTTAATCACCTCGTCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_201372.3-708s21c1
Sequence:CCGGCACCCGGAATTGGTAACATTCCTCGAGGAATGTTACCAATTCCGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_201372.3-946s21c1
Sequence:CCGGCTGGCAGTCCAGGCATCAATTCTCGAGAATTGATGCCTGGACTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198563    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201372.1-441s1c1
Sequence:CCGGGCTTGGATTCCTATGAGGAAACTCGAGTTTCCTCATAGGAATCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182862    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201372.1-402s1c1
Sequence:CCGGCCCAGGATTATGCACGGTTTACTCGAGTAAACCGTGCATAATCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182073    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201372.1-343s1c1
Sequence:CCGGCAAATTCTGGTGGGAGAACAACTCGAGTTGTTCTCCCACCAGAATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181697    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201372.1-403s1c1
Sequence:CCGGCCAGGATTATGCACGGTTTAACTCGAGTTAAACCGTGCATAATCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181525    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201372.1-470s1c1
Sequence:CCGGGAGGTGATTAAAGAGATGGCACTCGAGTGCCATCTCTTTAATCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181786    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201372.1-371s1c1
Sequence:CCGGGCCCAGATGAAAGAGAAGTTTCTCGAGAAACTTCTCTTTCATCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182433    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201372.1-530s1c1
Sequence:CCGGGTCCGATCTGTCTTAGAGGTTCTCGAGAACCTCTAAGACAGATCGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks