EMAIL THIS PAGE TO A FRIEND

CCDC85A

coiled-coil domain containing 85A

UniProtKB ID: Q96PX6
Gene ID:
Mouse(216613) coiled-coil domain containing 85A
Rat(289855) coiled-coil domain containing 85A
Zebrafish(100141348) coiled-coil domain containing 85A
cow(525800) coiled-coil domain containing 85A
Horse(100052299) coiled-coil domain containing 85A
domestic cat(101094840) coiled-coil domain containing 85A
dog(481377) coiled-coil domain containing 85A
chicken(421205) coiled-coil domain containing 85A
naked mole-rat(101703955) coiled-coil domain containing 85A
domestic guinea pig(100721319) coiled-coil domain containing 85A
sheep(101120398) coiled-coil domain containing 85A
180 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181577 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181577 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181577 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001080433 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080433 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080433 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080433 Rosetta Predictions human pricing
XM_055636 Rosetta Predictions human pricing
XM_001064762 Rosetta Predictions rat pricing
XM_223723 Rosetta Predictions rat pricing
NM_181577 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080433 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314796 predicted 1734
2 SASI_Hs02_00314797 predicted 1976
3 SASI_Hs02_00314798 predicted 2190
4 SASI_Hs02_00314799 predicted 2260
5 SASI_Hs02_00314800 predicted 2152
6 SASI_Hs02_00314801 predicted 2051
7 SASI_Hs02_00314802 predicted 2106
8 SASI_Hs02_00314803 predicted 1942
9 SASI_Hs02_00314804 predicted 2184
10 SASI_Hs02_00314805 predicted 2243
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_055636 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00268200 predicted 1733
2 SASI_Hs01_00268201 predicted 1983
3 SASI_Hs01_00268202 predicted 2260
4 SASI_Hs01_00268203 predicted 1845
5 SASI_Hs01_00268204 predicted 2146
6 SASI_Hs01_00268205 predicted 2058
7 SASI_Hs01_00268206 predicted 2104
8 SASI_Hs01_00268207 predicted 1936
9 SASI_Hs01_00268208 predicted 2185
10 SASI_Hs01_00268209 predicted 2239
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064762 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00311665 predicted 488
2 SASI_Rn02_00311666 predicted 1017
3 SASI_Rn02_00311667 predicted 725
4 SASI_Rn02_00311668 predicted 575
5 SASI_Rn02_00311669 predicted 1124
6 SASI_Rn02_00311670 predicted 598
7 SASI_Rn02_00311671 predicted 748
8 SASI_Rn02_00311672 predicted 317
9 SASI_Rn02_00311673 predicted 470
10 SASI_Rn02_00311674 predicted 876
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_223723 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00381620 predicted 489
2 SASI_Rn02_00381621 predicted 1022
3 SASI_Rn02_00381622 predicted 719
4 SASI_Rn02_00381623 predicted 576
5 SASI_Rn02_00381624 predicted 1123
6 SASI_Rn02_00381625 predicted 597
7 SASI_Rn02_00381626 predicted 747
8 SASI_Rn02_00381627 predicted 315
9 SASI_Rn02_00381628 predicted 470
10 SASI_Rn02_00381629 predicted 876
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181577 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00124843 predicted 1490
2 SASI_Mm01_00124844 predicted 1493
3 SASI_Mm01_00124845 predicted 1534
4 SASI_Mm01_00124846 predicted 1492
5 SASI_Mm02_00349835 predicted 2006
6 SASI_Mm01_00124847 predicted 1108
7 SASI_Mm01_00124848 predicted 2068
8 SASI_Mm01_00124849 predicted 1369
9 SASI_Mm01_00124850 predicted 1999
10 SASI_Mm02_00349836 predicted 1942
11 SASI_Mm01_00124842 predicted 1012
12 SASI_Mm01_00124851 predicted 1662
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181577
CCDC85A MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 85A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181577.2-1918s1c1
Sequence:CCGGCTGCTCAAGAGGATTCATCATCTCGAGATGATGAATCCTCTTGAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181577.2-1680s1c1
Sequence:CCGGCCTGAACATTTCCAGAAGCATCTCGAGATGCTTCTGGAAATGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181577.2-1816s1c1
Sequence:CCGGCAGAGCATCTCAAACAACATTCTCGAGAATGTTGTTTGAGATGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181577.2-1010s1c1
Sequence:CCGGGCTCAAGGATATTAACCAGAACTCGAGTTCTGGTTAATATCCTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181577.2-1967s1c1
Sequence:CCGGGAATGAATCAACCTTGTCCTACTCGAGTAGGACAAGGTTGATTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181577
CCDC85A MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 85A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181577.2-1918s1c1
Sequence:CCGGCTGCTCAAGAGGATTCATCATCTCGAGATGATGAATCCTCTTGAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181577.2-1680s1c1
Sequence:CCGGCCTGAACATTTCCAGAAGCATCTCGAGATGCTTCTGGAAATGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181577.2-1816s1c1
Sequence:CCGGCAGAGCATCTCAAACAACATTCTCGAGAATGTTGTTTGAGATGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181577.2-1010s1c1
Sequence:CCGGGCTCAAGGATATTAACCAGAACTCGAGTTCTGGTTAATATCCTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181577.2-1967s1c1
Sequence:CCGGGAATGAATCAACCTTGTCCTACTCGAGTAGGACAAGGTTGATTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181577
CCDC85A MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 85A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181577.2-1918s1c1
Sequence:CCGGCTGCTCAAGAGGATTCATCATCTCGAGATGATGAATCCTCTTGAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181577.2-1680s1c1
Sequence:CCGGCCTGAACATTTCCAGAAGCATCTCGAGATGCTTCTGGAAATGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181577.2-1816s1c1
Sequence:CCGGCAGAGCATCTCAAACAACATTCTCGAGAATGTTGTTTGAGATGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181577.2-1010s1c1
Sequence:CCGGGCTCAAGGATATTAACCAGAACTCGAGTTCTGGTTAATATCCTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181577.2-1967s1c1
Sequence:CCGGGAATGAATCAACCTTGTCCTACTCGAGTAGGACAAGGTTGATTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080433
CCDC85A MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 85A
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257467    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080433.1-3497s21c1
Sequence:CCGGGCTCATTACATAACGAGTTAACTCGAGTTAACTCGTTATGTAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080433.1-1844s21c1
Sequence:CCGGCCAACTAGAAACAGCTCAAATCTCGAGATTTGAGCTGTTTCTAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080433.1-2047s21c1
Sequence:CCGGGCCTGAACCTGTGGTACATTCCTCGAGGAATGTACCACAGGTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080433.1-2104s21c1
Sequence:CCGGAGGTTCGTGTCCTGGAATTAGCTCGAGCTAATTCCAGGACACGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080433.1-913s21c1
Sequence:CCGGGCACAAGGAAGTGGCCTTATACTCGAGTATAAGGCCACTTCCTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080433
CCDC85A MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 85A
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257467    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080433.1-3497s21c1
Sequence:CCGGGCTCATTACATAACGAGTTAACTCGAGTTAACTCGTTATGTAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080433.1-1844s21c1
Sequence:CCGGCCAACTAGAAACAGCTCAAATCTCGAGATTTGAGCTGTTTCTAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080433.1-2047s21c1
Sequence:CCGGGCCTGAACCTGTGGTACATTCCTCGAGGAATGTACCACAGGTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080433.1-2104s21c1
Sequence:CCGGAGGTTCGTGTCCTGGAATTAGCTCGAGCTAATTCCAGGACACGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080433.1-913s21c1
Sequence:CCGGGCACAAGGAAGTGGCCTTATACTCGAGTATAAGGCCACTTCCTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080433
CCDC85A MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 85A
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257467    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080433.1-3497s21c1
Sequence:CCGGGCTCATTACATAACGAGTTAACTCGAGTTAACTCGTTATGTAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080433.1-1844s21c1
Sequence:CCGGCCAACTAGAAACAGCTCAAATCTCGAGATTTGAGCTGTTTCTAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080433.1-2047s21c1
Sequence:CCGGGCCTGAACCTGTGGTACATTCCTCGAGGAATGTACCACAGGTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080433.1-2104s21c1
Sequence:CCGGAGGTTCGTGTCCTGGAATTAGCTCGAGCTAATTCCAGGACACGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080433.1-913s21c1
Sequence:CCGGGCACAAGGAAGTGGCCTTATACTCGAGTATAAGGCCACTTCCTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks