EMAIL THIS PAGE TO A FRIEND

CCDC85B

coiled-coil domain containing 85B

71 Gene Product Result for
Synonyms: DIPA
UniProtKB ID: Q15834, B2R598, Q96HA0
Gene ID:
Human(11007) Summary: Hepatitis delta virus (HDV) is a pathogenic human virus whose RNA genome and replication cycle resemble those of plant viroids. Delta-interacting protein A (DIPA), a cellular gene product, has been found to have homology to hepatitis delta virus antigen (HDAg). DIPA interacts with the viral antigen, HDAg, and can affect HDV replication in vitro. [provided by RefSeq, Jul 2008]
Mouse(240514) coiled-coil domain containing 85B
Rat(309161) coiled-coil domain containing 85B
Zebrafish(564324) coiled-coil domain containing 85B
dog(610847) coiled-coil domain containing 85B
cow(540332) coiled-coil domain containing 85B
sheep(101103437) coiled-coil domain containing 85B
domestic guinea pig(100734149) coiled-coil domain containing 85B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198616 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198616 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198616 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006848 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006848 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006848 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006848 Rosetta Predictions human pricing
XM_001070153 Rosetta Predictions rat pricing
XM_219510 Rosetta Predictions rat pricing
NM_198616 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006848 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228137 predicted 598
2 SASI_Hs01_00228138 predicted 595
3 SASI_Hs01_00228134 predicted 578
4 SASI_Hs01_00228135 predicted 573
5 SASI_Hs01_00228136 predicted 551
6 SASI_Hs01_00228139 predicted 591
7 SASI_Hs01_00228141 predicted 1089
8 SASI_Hs01_00228143 predicted 1160
9 SASI_Hs02_00342447 predicted 1103
10 SASI_Hs02_00342448 predicted 910
11 SASI_Hs01_00228140 predicted 773
12 SASI_Hs01_00228142 predicted 558
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070153 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00330606 predicted 1134
2 SASI_Rn02_00330607 predicted 768
3 SASI_Rn02_00330608 predicted 1027
4 SASI_Rn02_00330609 predicted 899
5 SASI_Rn02_00330610 predicted 1764
6 SASI_Rn02_00330611 predicted 1248
7 SASI_Rn02_00330612 predicted 1705
8 SASI_Rn02_00330613 predicted 1146
9 SASI_Rn02_00330614 predicted 1576
10 SASI_Rn02_00330615 predicted 1614
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_219510 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00378525 predicted 1134
2 SASI_Rn02_00378526 predicted 766
3 SASI_Rn02_00378527 predicted 1018
4 SASI_Rn02_00378528 predicted 902
5 SASI_Rn02_00378529 predicted 1760
6 SASI_Rn02_00378530 predicted 1257
7 SASI_Rn02_00378531 predicted 1708
8 SASI_Rn02_00378532 predicted 1152
9 SASI_Rn02_00378533 predicted 1579
10 SASI_Rn02_00378534 predicted 1618
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198616 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00351045 predicted 200
2 SASI_Mm02_00351046 predicted 947
3 SASI_Mm02_00351047 predicted 1123
4 SASI_Mm02_00351048 predicted 1086
5 SASI_Mm02_00351049 predicted 333
6 SASI_Mm01_00028373 predicted 331
7 SASI_Mm01_00028374 predicted 567
8 SASI_Mm02_00351050 predicted 1060
9 SASI_Mm02_00351051 predicted 793
10 SASI_Mm02_00351052 predicted 721
11 SASI_Mm01_00028372 predicted 675
12 SASI_Mm01_00028375 predicted 613
13 SASI_Mm01_00028376 predicted 436
14 SASI_Mm01_00028377 predicted 350
15 SASI_Mm01_00028378 predicted 676
16 SASI_Mm01_00028379 predicted 277
17 SASI_Mm01_00028380 predicted 433
18 SASI_Mm01_00028381 predicted 260
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198616
CCDC85B MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 85B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198616.2-340s21c1
Sequence:CCGGCGAGATCCGTGAGCTCAAACACTCGAGTGTTTGAGCTCACGGATCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198616.2-568s21c1
Sequence:CCGGTCTGGCCCTTAAGGAGCTTTGCTCGAGCAAAGCTCCTTAAGGGCCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198616.2-297s21c1
Sequence:CCGGGCCTGATGCAGGAGGTGAATCCTCGAGGATTCACCTCCTGCATCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248677    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198616.2-2949s21c1
Sequence:CCGGCAGAGTCCTGAGGAGTAATTTCTCGAGAAATTACTCCTCAGGACTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198616.2-696s21c1
Sequence:CCGGACCTAGGCGATGGAAGTTCCACTCGAGTGGAACTTCCATCGCCTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198616
CCDC85B MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 85B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198616.2-340s21c1
Sequence:CCGGCGAGATCCGTGAGCTCAAACACTCGAGTGTTTGAGCTCACGGATCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198616.2-568s21c1
Sequence:CCGGTCTGGCCCTTAAGGAGCTTTGCTCGAGCAAAGCTCCTTAAGGGCCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198616.2-297s21c1
Sequence:CCGGGCCTGATGCAGGAGGTGAATCCTCGAGGATTCACCTCCTGCATCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248677    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198616.2-2949s21c1
Sequence:CCGGCAGAGTCCTGAGGAGTAATTTCTCGAGAAATTACTCCTCAGGACTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198616.2-696s21c1
Sequence:CCGGACCTAGGCGATGGAAGTTCCACTCGAGTGGAACTTCCATCGCCTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198616
CCDC85B MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 85B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198616.2-340s21c1
Sequence:CCGGCGAGATCCGTGAGCTCAAACACTCGAGTGTTTGAGCTCACGGATCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198616.2-568s21c1
Sequence:CCGGTCTGGCCCTTAAGGAGCTTTGCTCGAGCAAAGCTCCTTAAGGGCCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198616.2-297s21c1
Sequence:CCGGGCCTGATGCAGGAGGTGAATCCTCGAGGATTCACCTCCTGCATCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248677    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198616.2-2949s21c1
Sequence:CCGGCAGAGTCCTGAGGAGTAATTTCTCGAGAAATTACTCCTCAGGACTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198616.2-696s21c1
Sequence:CCGGACCTAGGCGATGGAAGTTCCACTCGAGTGGAACTTCCATCGCCTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006848
VALIDATED
CCDC85B MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 85B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006848.2-981s21c1
Sequence:CCGGGATGATTGAAGGCACTGCTTCCTCGAGGAAGCAGTGCCTTCAATCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242754    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006848.2-1095s21c1
Sequence:CCGGCGCTGGCATGGACTAAGAAATCTCGAGATTTCTTAGTCCATGCCAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006848.2-511s21c1
Sequence:CCGGGCCTCATGCAGGAGGTGAATCCTCGAGGATTCACCTCCTGCATGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006848.2-435s21c1
Sequence:CCGGCTAGGCAAGGAAGAGCTAGTGCTCGAGCACTAGCTCTTCCTTGCCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006848.2-773s21c1
Sequence:CCGGGCGGGAGAACCTAGCGCTTAACTCGAGTTAAGCGCTAGGTTCTCCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006848
VALIDATED
CCDC85B MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 85B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006848.2-981s21c1
Sequence:CCGGGATGATTGAAGGCACTGCTTCCTCGAGGAAGCAGTGCCTTCAATCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242754    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006848.2-1095s21c1
Sequence:CCGGCGCTGGCATGGACTAAGAAATCTCGAGATTTCTTAGTCCATGCCAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006848.2-511s21c1
Sequence:CCGGGCCTCATGCAGGAGGTGAATCCTCGAGGATTCACCTCCTGCATGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006848.2-435s21c1
Sequence:CCGGCTAGGCAAGGAAGAGCTAGTGCTCGAGCACTAGCTCTTCCTTGCCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006848.2-773s21c1
Sequence:CCGGGCGGGAGAACCTAGCGCTTAACTCGAGTTAAGCGCTAGGTTCTCCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006848
VALIDATED
CCDC85B MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 85B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006848.2-981s21c1
Sequence:CCGGGATGATTGAAGGCACTGCTTCCTCGAGGAAGCAGTGCCTTCAATCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242754    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006848.2-1095s21c1
Sequence:CCGGCGCTGGCATGGACTAAGAAATCTCGAGATTTCTTAGTCCATGCCAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006848.2-511s21c1
Sequence:CCGGGCCTCATGCAGGAGGTGAATCCTCGAGGATTCACCTCCTGCATGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006848.2-435s21c1
Sequence:CCGGCTAGGCAAGGAAGAGCTAGTGCTCGAGCACTAGCTCTTCCTTGCCTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006848.2-773s21c1
Sequence:CCGGGCGGGAGAACCTAGCGCTTAACTCGAGTTAAGCGCTAGGTTCTCCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)