EMAIL THIS PAGE TO A FRIEND

CCDC85C

coiled-coil domain containing 85C

68 Gene Product Result for
UniProtKB ID: A6NKD9
Gene ID:
Mouse(668158) coiled-coil domain containing 85C
Rat(690965) coiled-coil domain containing 85C
naked mole-rat(101709661) coiled-coil domain containing 85C
domestic guinea pig(100729223) coiled-coil domain containing 85C
chicken(423447) coiled-coil domain containing 85C
cow(617455) coiled-coil domain containing 85C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001144995 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001144995 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001144995 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XR_040689 Rosetta Predictions human pricing
XR_040690 Rosetta Predictions human pricing
XR_040691 Rosetta Predictions human pricing
XM_001076332 Rosetta Predictions rat pricing
XM_001478583 Rosetta Predictions mouse pricing
XM_994648 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040689 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00521018 predicted 1308
2 SASI_Hs02_00521019 predicted 5442
3 SASI_Hs02_00521020 predicted 4461
4 SASI_Hs02_00521021 predicted 5482
5 SASI_Hs02_00521022 predicted 5444
6 SASI_Hs02_00521023 predicted 4457
7 SASI_Hs02_00521024 predicted 901
8 SASI_Hs02_00521025 predicted 3664
9 SASI_Hs02_00521026 predicted 5468
10 SASI_Hs02_00521027 predicted 3592
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040690 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00521028 predicted 1305
2 SASI_Hs02_00521029 predicted 5445
3 SASI_Hs02_00521030 predicted 4469
4 SASI_Hs02_00521031 predicted 5488
5 SASI_Hs02_00521032 predicted 5453
6 SASI_Hs02_00521033 predicted 4462
7 SASI_Hs02_00521034 predicted 903
8 SASI_Hs02_00521035 predicted 3664
9 SASI_Hs02_00521036 predicted 3736
10 SASI_Hs02_00521037 predicted 5478
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040691 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00521038 predicted 1303
2 SASI_Hs02_00521039 predicted 5435
3 SASI_Hs02_00521040 predicted 4462
4 SASI_Hs02_00521041 predicted 5483
5 SASI_Hs02_00521042 predicted 5446
6 SASI_Hs02_00521043 predicted 4458
7 SASI_Hs02_00521044 predicted 899
8 SASI_Hs02_00521045 predicted 3661
9 SASI_Hs02_00521046 predicted 5473
10 SASI_Hs02_00521047 predicted 3589
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076332 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00352874 predicted 1074
2 SASI_Rn02_00352875 predicted 1040
3 SASI_Rn02_00352876 predicted 1084
4 SASI_Rn02_00352877 predicted 1046
5 SASI_Rn02_00352878 predicted 1091
6 SASI_Rn02_00352879 predicted 979
7 SASI_Rn02_00352880 predicted 989
8 SASI_Rn02_00352881 predicted 1072
9 SASI_Rn02_00352882 predicted 991
10 SASI_Rn02_00352883 predicted 1012
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001478583 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00403710 predicted 1141
2 SASI_Mm02_00403711 predicted 1049
3 SASI_Mm02_00403712 predicted 1208
4 SASI_Mm02_00403713 predicted 1090
5 SASI_Mm02_00403714 predicted 419
6 SASI_Mm02_00403715 predicted 1280
7 SASI_Mm02_00403716 predicted 1051
8 SASI_Mm02_00403717 predicted 1277
9 SASI_Mm02_00403718 predicted 1045
10 SASI_Mm02_00403719 predicted 471
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_994648 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00238785 predicted 1175
2 SASI_Mm01_00238786 predicted 1071
3 SASI_Mm01_00238787 predicted 1123
4 SASI_Mm01_00238788 predicted 1231
5 SASI_Mm01_00238789 predicted 1110
6 SASI_Mm01_00238790 predicted 1303
7 SASI_Mm01_00238791 predicted 1074
8 SASI_Mm01_00238792 predicted 1306
9 SASI_Mm01_00238793 predicted 1071
10 SASI_Mm01_00238794 predicted 1098
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001144995
VALIDATED
CCDC85C MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 85C
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000337164    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_001144995.1-2137s21c1
Sequence:CCGGGCACCACTTCTTGCCCAAATGCTCGAGCATTTGGGCAAGAAGTGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_001144995.1-1504s21c1
Sequence:CCGGTCCTGGAGGTACACGAGAATCCTCGAGGATTCTCGTGTACCTCCAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_001144995.1-1581s21c1
Sequence:CCGGATCGTTCGCGAGATGTGCAACCTCGAGGTTGCACATCTCGCGAACGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144995.1-1223s21c1
Sequence:CCGGCGATCCCTCATCCACCTACATCTCGAGATGTAGGTGGATGAGGGATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_001144995.1-1245s21c1
Sequence:CCGGAGGCAACTGGAGAGCAAAGTGCTCGAGCACTTTGCTCTCCAGTTGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001144995
VALIDATED
CCDC85C MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 85C
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000337164    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_001144995.1-2137s21c1
Sequence:CCGGGCACCACTTCTTGCCCAAATGCTCGAGCATTTGGGCAAGAAGTGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_001144995.1-1504s21c1
Sequence:CCGGTCCTGGAGGTACACGAGAATCCTCGAGGATTCTCGTGTACCTCCAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_001144995.1-1581s21c1
Sequence:CCGGATCGTTCGCGAGATGTGCAACCTCGAGGTTGCACATCTCGCGAACGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144995.1-1223s21c1
Sequence:CCGGCGATCCCTCATCCACCTACATCTCGAGATGTAGGTGGATGAGGGATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_001144995.1-1245s21c1
Sequence:CCGGAGGCAACTGGAGAGCAAAGTGCTCGAGCACTTTGCTCTCCAGTTGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001144995
VALIDATED
CCDC85C MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 85C
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000337164    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_001144995.1-2137s21c1
Sequence:CCGGGCACCACTTCTTGCCCAAATGCTCGAGCATTTGGGCAAGAAGTGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_001144995.1-1504s21c1
Sequence:CCGGTCCTGGAGGTACACGAGAATCCTCGAGGATTCTCGTGTACCTCCAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_001144995.1-1581s21c1
Sequence:CCGGATCGTTCGCGAGATGTGCAACCTCGAGGTTGCACATCTCGCGAACGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144995.1-1223s21c1
Sequence:CCGGCGATCCCTCATCCACCTACATCTCGAGATGTAGGTGGATGAGGGATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_001144995.1-1245s21c1
Sequence:CCGGAGGCAACTGGAGAGCAAAGTGCTCGAGCACTTTGCTCTCCAGTTGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)