EMAIL THIS PAGE TO A FRIEND

CCDC86

coiled-coil domain containing 86

51 Gene Product Result for
UniProtKB ID: Q9H6F5
Gene ID:
Mouse(108673) coiled-coil domain containing 86
Rat(293738) coiled-coil domain containing 86
chicken(425097) coiled-coil domain containing 86
cow(540913) coiled-coil domain containing 86
domestic cat(101080325) coiled-coil domain containing 86
dog(483806) coiled-coil domain containing 86
domestic guinea pig(100721410) coiled-coil domain containing 86
naked mole-rat(101719277) coiled-coil domain containing 86
sheep(101121127) coiled-coil domain containing 86
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023731 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023731 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023731 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024098 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024098 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024098 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024098 Rosetta Predictions human pricing
NM_001006974 Rosetta Predictions rat pricing
NM_023731 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024098 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00120886 predicted 1504
2 SASI_Hs01_00120887 predicted 929
3 SASI_Hs01_00120888 predicted 1299
4 SASI_Hs01_00120889 predicted 472
5 SASI_Hs01_00120891 predicted 900
6 SASI_Hs01_00120892 predicted 561
7 SASI_Hs01_00120893 predicted 1137
8 SASI_Hs01_00120894 predicted 523
9 SASI_Hs01_00120895 predicted 1521
10 SASI_Hs02_00356578 predicted 1113
11 SASI_Hs01_00120890 predicted 1124
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006974 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00100043 predicted 574
2 SASI_Rn02_00198534 predicted 698
3 SASI_Rn01_00100045 predicted 690
4 SASI_Rn01_00100046 predicted 703
5 SASI_Rn01_00100047 predicted 339
6 SASI_Rn01_00100050 predicted 319
7 SASI_Rn02_00198535 predicted 198
8 SASI_Rn01_00100051 predicted 347
9 SASI_Rn02_00198536 predicted 569
10 SASI_Rn02_00198537 predicted 470
11 SASI_Rn01_00100044 predicted 903
12 SASI_Rn01_00100048 predicted 721
13 SASI_Rn01_00100049 predicted 872
14 SASI_Rn01_00100052 predicted 409
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023731 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00108350 predicted 1142
2 SASI_Mm02_00327308 predicted 1223
3 SASI_Mm01_00108352 predicted 971
4 SASI_Mm01_00108353 predicted 851
5 SASI_Mm01_00108354 predicted 1317
6 SASI_Mm01_00108355 predicted 665
7 SASI_Mm01_00108356 predicted 991
8 SASI_Mm01_00108357 predicted 485
9 SASI_Mm01_00108358 predicted 1117
10 SASI_Mm01_00108359 predicted 572
11 SASI_Mm01_00108351 predicted 1391
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023731
VALIDATED
CCDC86 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 86
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023731.3-935s21c1
Sequence:CCGGTTCCGAAAGGGAAGCCCAAATCTCGAGATTTGGGCTTCCCTTTCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023731.3-1227s21c1
Sequence:CCGGGAAGAAGCAGTTGCGTTCTATCTCGAGATAGAACGCAACTGCTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023731.3-123s21c1
Sequence:CCGGGAAACGGGCTCTTGTAGATTTCTCGAGAAATCTACAAGAGCCCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336536    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023731.3-1490s21c1
Sequence:CCGGGCCTGTTCCAAAGTGCCTTATCTCGAGATAAGGCACTTTGGAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023731.3-857s21c1
Sequence:CCGGACCTAAAGAAGCGAGTTATAGCTCGAGCTATAACTCGCTTCTTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023731.1-1228s1c1
Sequence:CCGGGAAGAAGCAGTTGCGTTCTATCTCGAGATAGAACGCAACTGCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197417    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023731.1-1210s1c1
Sequence:CCGGCAAGCTCAAGAAAGCAAAGAACTCGAGTTCTTTGCTTTCTTGAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023731.1-856s1c1
Sequence:CCGGCAACCTAAAGAAGCGAGTTATCTCGAGATAACTCGCTTCTTTAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023731.1-854s1c1
Sequence:CCGGCTCAACCTAAAGAAGCGAGTTCTCGAGAACTCGCTTCTTTAGGTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181596    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023731.1-1491s1c1
Sequence:CCGGGCCTGTTCCAAAGTGCCTTATCTCGAGATAAGGCACTTTGGAACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023731.1-1183s1c1
Sequence:CCGGGATTGTCCAAGTGATCCGCAACTCGAGTTGCGGATCACTTGGACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023731
VALIDATED
CCDC86 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 86
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023731.3-935s21c1
Sequence:CCGGTTCCGAAAGGGAAGCCCAAATCTCGAGATTTGGGCTTCCCTTTCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023731.3-1227s21c1
Sequence:CCGGGAAGAAGCAGTTGCGTTCTATCTCGAGATAGAACGCAACTGCTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023731.3-123s21c1
Sequence:CCGGGAAACGGGCTCTTGTAGATTTCTCGAGAAATCTACAAGAGCCCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336536    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023731.3-1490s21c1
Sequence:CCGGGCCTGTTCCAAAGTGCCTTATCTCGAGATAAGGCACTTTGGAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023731.3-857s21c1
Sequence:CCGGACCTAAAGAAGCGAGTTATAGCTCGAGCTATAACTCGCTTCTTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023731.1-1228s1c1
Sequence:CCGGGAAGAAGCAGTTGCGTTCTATCTCGAGATAGAACGCAACTGCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197417    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023731.1-1210s1c1
Sequence:CCGGCAAGCTCAAGAAAGCAAAGAACTCGAGTTCTTTGCTTTCTTGAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023731.1-856s1c1
Sequence:CCGGCAACCTAAAGAAGCGAGTTATCTCGAGATAACTCGCTTCTTTAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023731.1-854s1c1
Sequence:CCGGCTCAACCTAAAGAAGCGAGTTCTCGAGAACTCGCTTCTTTAGGTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181596    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023731.1-1491s1c1
Sequence:CCGGGCCTGTTCCAAAGTGCCTTATCTCGAGATAAGGCACTTTGGAACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023731.1-1183s1c1
Sequence:CCGGGATTGTCCAAGTGATCCGCAACTCGAGTTGCGGATCACTTGGACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023731
VALIDATED
CCDC86 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 86
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023731.3-935s21c1
Sequence:CCGGTTCCGAAAGGGAAGCCCAAATCTCGAGATTTGGGCTTCCCTTTCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023731.3-1227s21c1
Sequence:CCGGGAAGAAGCAGTTGCGTTCTATCTCGAGATAGAACGCAACTGCTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023731.3-123s21c1
Sequence:CCGGGAAACGGGCTCTTGTAGATTTCTCGAGAAATCTACAAGAGCCCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336536    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023731.3-1490s21c1
Sequence:CCGGGCCTGTTCCAAAGTGCCTTATCTCGAGATAAGGCACTTTGGAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023731.3-857s21c1
Sequence:CCGGACCTAAAGAAGCGAGTTATAGCTCGAGCTATAACTCGCTTCTTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023731.1-1228s1c1
Sequence:CCGGGAAGAAGCAGTTGCGTTCTATCTCGAGATAGAACGCAACTGCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197417    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023731.1-1210s1c1
Sequence:CCGGCAAGCTCAAGAAAGCAAAGAACTCGAGTTCTTTGCTTTCTTGAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023731.1-856s1c1
Sequence:CCGGCAACCTAAAGAAGCGAGTTATCTCGAGATAACTCGCTTCTTTAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023731.1-854s1c1
Sequence:CCGGCTCAACCTAAAGAAGCGAGTTCTCGAGAACTCGCTTCTTTAGGTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181596    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023731.1-1491s1c1
Sequence:CCGGGCCTGTTCCAAAGTGCCTTATCTCGAGATAAGGCACTTTGGAACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023731.1-1183s1c1
Sequence:CCGGGATTGTCCAAGTGATCCGCAACTCGAGTTGCGGATCACTTGGACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024098
VALIDATED
CCDC86 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 86
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242470    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024098.3-1578s21c1
Sequence:CCGGTGACTCCCTCAGCAGTGTATGCTCGAGCATACACTGCTGAGGGAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_024098.3-835s21c1
Sequence:CCGGAGCGTCCAAGAAGTTGAATAACTCGAGTTATTCAACTTCTTGGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_024098.3-1121s21c1
Sequence:CCGGGTCGTCCAAGTGATCCGAAACCTCGAGGTTTCGGATCACTTGGACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024098.3-575s21c1
Sequence:CCGGTCGGAGTTGGCCCAGAATAAGCTCGAGCTTATTCTGGGCCAACTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_024098.3-487s21c1
Sequence:CCGGGCCAGAGTACAGTCCTGAATCCTCGAGGATTCAGGACTGTACTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183692    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024098.1-1418s1c1
Sequence:CCGGGAACTGTACATTCTTCTGGTTCTCGAGAACCAGAAGAATGTACAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179469    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024098.1-1405s1c1
Sequence:CCGGGCCTTCAAACCAAGAACTGTACTCGAGTACAGTTCTTGGTTTGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179863    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024098.1-1400s1c1
Sequence:CCGGCAAGTGCCTTCAAACCAAGAACTCGAGTTCTTGGTTTGAAGGCACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024098
VALIDATED
CCDC86 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 86
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242470    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024098.3-1578s21c1
Sequence:CCGGTGACTCCCTCAGCAGTGTATGCTCGAGCATACACTGCTGAGGGAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_024098.3-835s21c1
Sequence:CCGGAGCGTCCAAGAAGTTGAATAACTCGAGTTATTCAACTTCTTGGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_024098.3-1121s21c1
Sequence:CCGGGTCGTCCAAGTGATCCGAAACCTCGAGGTTTCGGATCACTTGGACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024098.3-575s21c1
Sequence:CCGGTCGGAGTTGGCCCAGAATAAGCTCGAGCTTATTCTGGGCCAACTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_024098.3-487s21c1
Sequence:CCGGGCCAGAGTACAGTCCTGAATCCTCGAGGATTCAGGACTGTACTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183692    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024098.1-1418s1c1
Sequence:CCGGGAACTGTACATTCTTCTGGTTCTCGAGAACCAGAAGAATGTACAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179469    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024098.1-1405s1c1
Sequence:CCGGGCCTTCAAACCAAGAACTGTACTCGAGTACAGTTCTTGGTTTGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179863    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024098.1-1400s1c1
Sequence:CCGGCAAGTGCCTTCAAACCAAGAACTCGAGTTCTTGGTTTGAAGGCACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024098
VALIDATED
CCDC86 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 86
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242470    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024098.3-1578s21c1
Sequence:CCGGTGACTCCCTCAGCAGTGTATGCTCGAGCATACACTGCTGAGGGAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_024098.3-835s21c1
Sequence:CCGGAGCGTCCAAGAAGTTGAATAACTCGAGTTATTCAACTTCTTGGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_024098.3-1121s21c1
Sequence:CCGGGTCGTCCAAGTGATCCGAAACCTCGAGGTTTCGGATCACTTGGACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024098.3-575s21c1
Sequence:CCGGTCGGAGTTGGCCCAGAATAAGCTCGAGCTTATTCTGGGCCAACTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_024098.3-487s21c1
Sequence:CCGGGCCAGAGTACAGTCCTGAATCCTCGAGGATTCAGGACTGTACTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183692    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024098.1-1418s1c1
Sequence:CCGGGAACTGTACATTCTTCTGGTTCTCGAGAACCAGAAGAATGTACAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179469    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024098.1-1405s1c1
Sequence:CCGGGCCTTCAAACCAAGAACTGTACTCGAGTACAGTTCTTGGTTTGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179863    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024098.1-1400s1c1
Sequence:CCGGCAAGTGCCTTCAAACCAAGAACTCGAGTTCTTGGTTTGAAGGCACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks