EMAIL THIS PAGE TO A FRIEND

CCDC88A

coiled-coil domain containing 88A

233 Gene Product Result for
Synonyms: APE GIRDIN GIV GRDN HkRP1 KIAA1212
Gene ID:
Human(55704) Summary: This gene encodes a member of the Girdin family of coiled-coil domain containing proteins. The encoded protein is an actin-binding protein that is activated by the serine/threonine kinase Akt and plays a role in cytoskeleton remodeling and cell migration. The encoded protein also enhances Akt signaling by mediating phosphoinositide 3-kinase (PI3K)-dependent activation of Akt by growth factor receptor tyrosine kinases and G protein-coupled receptors. Increased expression of this gene and phosphorylation of the encoded protein may play a role in cancer metastasis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Mouse(108686) coiled coil domain containing 88A
Rat(305605) coiled coil domain containing 88A
chicken(421210) coiled-coil domain containing 88A
domestic cat(101096803) coiled-coil domain containing 88A
cow(533248) coiled-coil domain containing 88A
Horse(100052471) coiled-coil domain containing 88A
dog(481375) coiled-coil domain containing 88A
domestic guinea pig(100714383) coiled-coil domain containing 88A
naked mole-rat(101708183) coiled-coil domain containing 88A
sheep(101122010) coiled-coil domain containing 88A
Domestic Rabbit(100346692) coiled-coil domain containing 88A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_176841 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_176841 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_176841 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018084 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018084 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018084 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018084 Rosetta Predictions human pricing
XM_001065246 Rosetta Predictions rat pricing
XM_223709 Rosetta Predictions rat pricing
NM_176841 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018084 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00229319 predicted 4093
2 SASI_Hs01_00229320 predicted 3096
3 SASI_Hs01_00229321 predicted 2120
4 SASI_Hs01_00229323 predicted 5254
5 SASI_Hs01_00229324 predicted 5898
6 SASI_Hs02_00351250 predicted 4029
7 SASI_Hs02_00351251 predicted 5732
8 SASI_Hs02_00351252 predicted 4964
9 SASI_Hs02_00351253 predicted 6055
10 SASI_Hs02_00351254 predicted 1736
11 SASI_Hs01_00229315 predicted 967
12 SASI_Hs01_00229316 predicted 2185
13 SASI_Hs01_00229317 predicted 5388
14 SASI_Hs01_00229318 predicted 5490
15 SASI_Hs01_00229322 predicted 2321
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065246 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00313398 predicted 5032
2 SASI_Rn02_00313399 predicted 2293
3 SASI_Rn02_00313400 predicted 4174
4 SASI_Rn02_00313401 predicted 5222
5 SASI_Rn02_00313402 predicted 5975
6 SASI_Rn02_00313403 predicted 4110
7 SASI_Rn02_00313404 predicted 1353
8 SASI_Rn02_00313405 predicted 4611
9 SASI_Rn02_00313406 predicted 5089
10 SASI_Rn02_00313407 predicted 2796
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_223709 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00381600 predicted 4760
2 SASI_Rn02_00381601 predicted 2019
3 SASI_Rn02_00381602 predicted 3897
4 SASI_Rn02_00381603 predicted 4943
5 SASI_Rn02_00381604 predicted 5704
6 SASI_Rn02_00381605 predicted 3828
7 SASI_Rn02_00381606 predicted 1080
8 SASI_Rn02_00381607 predicted 4344
9 SASI_Rn02_00381608 predicted 4027
10 SASI_Rn02_00381609 predicted 4817
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176841 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00068914 predicted 4260
2 SASI_Mm01_00068915 predicted 662
3 SASI_Mm01_00068916 predicted 5215
4 SASI_Mm01_00068917 predicted 2286
5 SASI_Mm01_00068919 predicted 1351
6 SASI_Mm01_00068920 predicted 1040
7 SASI_Mm01_00068921 predicted 5081
8 SASI_Mm02_00346727 predicted 2798
9 SASI_Mm01_00068922 predicted 788
10 SASI_Mm01_00068923 predicted 4023
11 SASI_Mm01_00068918 predicted 5740
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176841
CCDC88A MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 88A
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217368    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_176841.3-6790s1c1
Sequence:CCGGGATAAGCTGCACTAGGTATTCCTCGAGGAATACCTAGTGCAGCTTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215440    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_176841.3-6209s1c1
Sequence:CCGGGCAACTATAGGAACTATTAAACTCGAGTTTAATAGTTCCTATAGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200269    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176841.2-2168s1c1
Sequence:CCGGCAGTCGATTCATCACCACCTACTCGAGTAGGTGGTGATGAATCGACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182719    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176841.2-979s1c1
Sequence:CCGGCGGGAACGTCAGAAATCTCTACTCGAGTAGAGATTTCTGACGTTCCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176841.2-322s1c1
Sequence:CCGGGTGGAACATAAAGACCTTGAACTCGAGTTCAAGGTCTTTATGTTCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176841.2-1363s1c1
Sequence:CCGGCCACAAGGTATTAGTGATGATCTCGAGATCATCACTAATACCTTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176841.2-1313s1c1
Sequence:CCGGCCAAGCAGTTGGTTAATAATACTCGAGTATTATTAACCAACTGCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176841.2-1743s1c1
Sequence:CCGGGCTTACCTCAATACAGTTGAACTCGAGTTCAACTGTATTGAGGTAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181335    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176841.2-1990s1c1
Sequence:CCGGCCAAGCACTCAAGGAAAGATACTCGAGTATCTTTCCTTGAGTGCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176841
CCDC88A MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 88A
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217368    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_176841.3-6790s1c1
Sequence:CCGGGATAAGCTGCACTAGGTATTCCTCGAGGAATACCTAGTGCAGCTTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215440    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_176841.3-6209s1c1
Sequence:CCGGGCAACTATAGGAACTATTAAACTCGAGTTTAATAGTTCCTATAGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200269    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176841.2-2168s1c1
Sequence:CCGGCAGTCGATTCATCACCACCTACTCGAGTAGGTGGTGATGAATCGACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182719    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176841.2-979s1c1
Sequence:CCGGCGGGAACGTCAGAAATCTCTACTCGAGTAGAGATTTCTGACGTTCCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176841.2-322s1c1
Sequence:CCGGGTGGAACATAAAGACCTTGAACTCGAGTTCAAGGTCTTTATGTTCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176841.2-1363s1c1
Sequence:CCGGCCACAAGGTATTAGTGATGATCTCGAGATCATCACTAATACCTTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176841.2-1313s1c1
Sequence:CCGGCCAAGCAGTTGGTTAATAATACTCGAGTATTATTAACCAACTGCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176841.2-1743s1c1
Sequence:CCGGGCTTACCTCAATACAGTTGAACTCGAGTTCAACTGTATTGAGGTAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181335    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176841.2-1990s1c1
Sequence:CCGGCCAAGCACTCAAGGAAAGATACTCGAGTATCTTTCCTTGAGTGCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176841
CCDC88A MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 88A
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217368    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_176841.3-6790s1c1
Sequence:CCGGGATAAGCTGCACTAGGTATTCCTCGAGGAATACCTAGTGCAGCTTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215440    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_176841.3-6209s1c1
Sequence:CCGGGCAACTATAGGAACTATTAAACTCGAGTTTAATAGTTCCTATAGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200269    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176841.2-2168s1c1
Sequence:CCGGCAGTCGATTCATCACCACCTACTCGAGTAGGTGGTGATGAATCGACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182719    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176841.2-979s1c1
Sequence:CCGGCGGGAACGTCAGAAATCTCTACTCGAGTAGAGATTTCTGACGTTCCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176841.2-322s1c1
Sequence:CCGGGTGGAACATAAAGACCTTGAACTCGAGTTCAAGGTCTTTATGTTCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176841.2-1363s1c1
Sequence:CCGGCCACAAGGTATTAGTGATGATCTCGAGATCATCACTAATACCTTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176841.2-1313s1c1
Sequence:CCGGCCAAGCAGTTGGTTAATAATACTCGAGTATTATTAACCAACTGCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176841.2-1743s1c1
Sequence:CCGGGCTTACCTCAATACAGTTGAACTCGAGTTCAACTGTATTGAGGTAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181335    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176841.2-1990s1c1
Sequence:CCGGCCAAGCACTCAAGGAAAGATACTCGAGTATCTTTCCTTGAGTGCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018084
VALIDATED
CCDC88A MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 88A
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130452    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018084.3-7570s1c1
Sequence:CCGGGCTTTCATTACCAGCTCTGAACTCGAGTTCAGAGCTGGTAATGAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_018084.3-2550s1c1
Sequence:CCGGGCAAGCTAAGCAAGATTGAATCTCGAGATTCAATCTTGCTTAGCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149922    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018084.3-3677s1c1
Sequence:CCGGGCTGCTTTAGAAGCTCGATTACTCGAGTAATCGAGCTTCTAAAGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149844    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018084.3-1662s1c1
Sequence:CCGGCCAGAATGTACCGAGATGAATCTCGAGATTCATCTCGGTACATTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018084.3-5959s1c1
Sequence:CCGGCTTCATTAGTTCTGCGGGAAACTCGAGTTTCCCGCAGAACTAATGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018084.3-1218s1c1
Sequence:CCGGCCGCACATATTCAAGAGGTAACTCGAGTTACCTCTTGAATATGTGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018084
VALIDATED
CCDC88A MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 88A
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130452    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018084.3-7570s1c1
Sequence:CCGGGCTTTCATTACCAGCTCTGAACTCGAGTTCAGAGCTGGTAATGAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_018084.3-2550s1c1
Sequence:CCGGGCAAGCTAAGCAAGATTGAATCTCGAGATTCAATCTTGCTTAGCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149922    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018084.3-3677s1c1
Sequence:CCGGGCTGCTTTAGAAGCTCGATTACTCGAGTAATCGAGCTTCTAAAGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149844    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018084.3-1662s1c1
Sequence:CCGGCCAGAATGTACCGAGATGAATCTCGAGATTCATCTCGGTACATTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018084.3-5959s1c1
Sequence:CCGGCTTCATTAGTTCTGCGGGAAACTCGAGTTTCCCGCAGAACTAATGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018084.3-1218s1c1
Sequence:CCGGCCGCACATATTCAAGAGGTAACTCGAGTTACCTCTTGAATATGTGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018084
VALIDATED
CCDC88A MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 88A
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130452    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018084.3-7570s1c1
Sequence:CCGGGCTTTCATTACCAGCTCTGAACTCGAGTTCAGAGCTGGTAATGAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_018084.3-2550s1c1
Sequence:CCGGGCAAGCTAAGCAAGATTGAATCTCGAGATTCAATCTTGCTTAGCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149922    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018084.3-3677s1c1
Sequence:CCGGGCTGCTTTAGAAGCTCGATTACTCGAGTAATCGAGCTTCTAAAGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149844    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018084.3-1662s1c1
Sequence:CCGGCCAGAATGTACCGAGATGAATCTCGAGATTCATCTCGGTACATTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018084.3-5959s1c1
Sequence:CCGGCTTCATTAGTTCTGCGGGAAACTCGAGTTTCCCGCAGAACTAATGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018084.3-1218s1c1
Sequence:CCGGCCGCACATATTCAAGAGGTAACTCGAGTTACCTCTTGAATATGTGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)