EMAIL THIS PAGE TO A FRIEND

CCDC88B

coiled-coil domain containing 88B

99 Gene Product Result for
Synonyms: BRLZ CCDC88 HKRP3 gipie
Gene ID:
Human(283234) Summary: This gene encodes a member of the hook-related protein family. Members of this family are characterized by an N-terminal potential microtubule binding domain, a central coiled-coiled and a C-terminal Hook-related domain. The encoded protein may be involved in linking organelles to microtubules. [provided by RefSeq, Oct 2009]
Mouse(78317) coiled-coil domain containing 88B
Rat(293698) coiled-coil domain containing 88B
Zebrafish(100330741) coiled-coil domain containing 88B
domestic cat(101100333) coiled-coil domain containing 88B
dog(483762) coiled-coil domain containing 88B
cow(510943) coiled-coil domain containing 88B
sheep(101116874) coiled-coil domain containing 88B
naked mole-rat(101722675) coiled-coil domain containing 88B
domestic guinea pig(100734989) coiled-coil domain containing 88B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032251 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032251 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032251 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081291 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081291 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081291 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU172411 MISSION® esiRNA esiRNA targeting mouse Ccdc88b mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032251 Rosetta Predictions human pricing
XM_001072042 Rosetta Predictions rat pricing
XM_215206 Rosetta Predictions rat pricing
NM_001081291 Rosetta Predictions mouse pricing
XM_887102 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032251 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00232197 predicted 403
2 SASI_Hs01_00232198 predicted 3462
3 SASI_Hs01_00232199 predicted 905
4 SASI_Hs01_00232200 predicted 1817
5 SASI_Hs01_00232201 predicted 4416
6 SASI_Hs01_00232202 predicted 4424
7 SASI_Hs01_00232203 predicted 466
8 SASI_Hs01_00232204 predicted 2973
9 SASI_Hs01_00232205 predicted 1517
10 SASI_Hs01_00232206 predicted 4340
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072042 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00337544 predicted 873
2 SASI_Rn02_00337545 predicted 450
3 SASI_Rn02_00337546 predicted 1777
4 SASI_Rn02_00337547 predicted 1831
5 SASI_Rn02_00337548 predicted 2234
6 SASI_Rn02_00337549 predicted 1608
7 SASI_Rn02_00337550 predicted 1781
8 SASI_Rn02_00337551 predicted 2186
9 SASI_Rn02_00337552 predicted 1042
10 SASI_Rn02_00337553 predicted 2186
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_215206 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00375865 predicted 640
2 SASI_Rn02_00375866 predicted 553
3 SASI_Rn02_00375867 predicted 592
4 SASI_Rn02_00375868 predicted 636
5 SASI_Rn02_00375869 predicted 483
6 SASI_Rn02_00375870 predicted 607
7 SASI_Rn02_00375871 predicted 636
8 SASI_Rn02_00375872 predicted 491
9 SASI_Rn02_00375873 predicted 632
10 SASI_Rn02_00375874 predicted 549
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081291 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00297031 predicted 1858
2 SASI_Mm02_00297032 predicted 1690
3 SASI_Mm02_00297033 predicted 1919
4 SASI_Mm02_00297034 predicted 2270
5 SASI_Mm02_00297035 predicted 2268
6 SASI_Mm02_00297036 predicted 3031
7 SASI_Mm02_00297037 predicted 530
8 SASI_Mm02_00297038 predicted 812
9 SASI_Mm02_00297039 predicted 2874
10 SASI_Mm02_00297040 predicted 2334
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_887102 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00245122 predicted 4735
2 SASI_Mm01_00245123 predicted 4737
3 SASI_Mm01_00245124 predicted 4730
4 SASI_Mm01_00245125 predicted 1871
5 SASI_Mm01_00245126 predicted 2116
6 SASI_Mm01_00245127 predicted 4039
7 SASI_Mm01_00245128 predicted 1924
8 SASI_Mm01_00245129 predicted 2766
9 SASI_Mm01_00245130 predicted 3045
10 SASI_Mm01_00245131 predicted 1825
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032251
CCDC88B MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 88B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164284    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032251.3-4716s1c1
Sequence:CCGGCTGCAGGAACACGAAACAGATCTCGAGATCTGTTTCGTGTTCCTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164135    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032251.3-181s1c1
Sequence:CCGGCCCTTTGGTTGGAGAAGAGATCTCGAGATCTCTTCTCCAACCAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163497    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032251.3-3367s1c1
Sequence:CCGGGAGAAGTCTGTGCTGGAGATTCTCGAGAATCTCCAGCACAGACTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163739    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032251.3-153s1c1
Sequence:CCGGGAAGAAGAGGAAGAGGAGGAACTCGAGTTCCTCCTCTTCCTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163930    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032251.3-4200s1c1
Sequence:CCGGGAGTACCTGGACCAGCTTAATCTCGAGATTAAGCTGGTCCAGGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032251
CCDC88B MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 88B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164284    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032251.3-4716s1c1
Sequence:CCGGCTGCAGGAACACGAAACAGATCTCGAGATCTGTTTCGTGTTCCTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164135    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032251.3-181s1c1
Sequence:CCGGCCCTTTGGTTGGAGAAGAGATCTCGAGATCTCTTCTCCAACCAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163497    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032251.3-3367s1c1
Sequence:CCGGGAGAAGTCTGTGCTGGAGATTCTCGAGAATCTCCAGCACAGACTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163739    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032251.3-153s1c1
Sequence:CCGGGAAGAAGAGGAAGAGGAGGAACTCGAGTTCCTCCTCTTCCTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163930    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032251.3-4200s1c1
Sequence:CCGGGAGTACCTGGACCAGCTTAATCTCGAGATTAAGCTGGTCCAGGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032251
CCDC88B MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 88B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164284    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032251.3-4716s1c1
Sequence:CCGGCTGCAGGAACACGAAACAGATCTCGAGATCTGTTTCGTGTTCCTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164135    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032251.3-181s1c1
Sequence:CCGGCCCTTTGGTTGGAGAAGAGATCTCGAGATCTCTTCTCCAACCAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163497    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032251.3-3367s1c1
Sequence:CCGGGAGAAGTCTGTGCTGGAGATTCTCGAGAATCTCCAGCACAGACTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163739    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032251.3-153s1c1
Sequence:CCGGGAAGAAGAGGAAGAGGAGGAACTCGAGTTCCTCCTCTTCCTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163930    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032251.3-4200s1c1
Sequence:CCGGGAGTACCTGGACCAGCTTAATCTCGAGATTAAGCTGGTCCAGGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081291
CCDC88B MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 88B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000249198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081291.1-3384s21c1
Sequence:CCGGCCGAGATCTCAAGGCCAATATCTCGAGATATTGGCCTTGAGATCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081291.1-2308s21c1
Sequence:CCGGGTTGCAGGCCTTGAGGTTAAACTCGAGTTTAACCTCAAGGCCTGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081291.1-4295s21c1
Sequence:CCGGGGCGAAGCTCTGCGTCATTTACTCGAGTAAATGACGCAGAGCTTCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249201    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081291.1-4711s21c1
Sequence:CCGGGGGAGATGATTGGTCCAAACCCTCGAGGGTTTGGACCAATCATCTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081291.1-3027s21c1
Sequence:CCGGCATCGAAGTGGAGCGAAATAACTCGAGTTATTTCGCTCCACTTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081291
CCDC88B MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 88B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000249198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081291.1-3384s21c1
Sequence:CCGGCCGAGATCTCAAGGCCAATATCTCGAGATATTGGCCTTGAGATCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081291.1-2308s21c1
Sequence:CCGGGTTGCAGGCCTTGAGGTTAAACTCGAGTTTAACCTCAAGGCCTGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081291.1-4295s21c1
Sequence:CCGGGGCGAAGCTCTGCGTCATTTACTCGAGTAAATGACGCAGAGCTTCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249201    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081291.1-4711s21c1
Sequence:CCGGGGGAGATGATTGGTCCAAACCCTCGAGGGTTTGGACCAATCATCTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081291.1-3027s21c1
Sequence:CCGGCATCGAAGTGGAGCGAAATAACTCGAGTTATTTCGCTCCACTTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081291
CCDC88B MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 88B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000249198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081291.1-3384s21c1
Sequence:CCGGCCGAGATCTCAAGGCCAATATCTCGAGATATTGGCCTTGAGATCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081291.1-2308s21c1
Sequence:CCGGGTTGCAGGCCTTGAGGTTAAACTCGAGTTTAACCTCAAGGCCTGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081291.1-4295s21c1
Sequence:CCGGGGCGAAGCTCTGCGTCATTTACTCGAGTAAATGACGCAGAGCTTCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249201    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081291.1-4711s21c1
Sequence:CCGGGGGAGATGATTGGTCCAAACCCTCGAGGGTTTGGACCAATCATCTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081291.1-3027s21c1
Sequence:CCGGCATCGAAGTGGAGCGAAATAACTCGAGTTATTTCGCTCCACTTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks