EMAIL THIS PAGE TO A FRIEND

CCDC88C

coiled-coil domain containing 88C

122 Gene Product Result for
Synonyms: DAPLE HKRP2 KIAA1509
UniProtKB ID: Q9P219, Q69YK1, Q7L1M2, Q86SX7, Q8IYG8
Gene ID:
Human(440193) Summary: This gene encodes a ubiquitously expressed coiled-coil domain-containing protein that interacts with the dishevelled protein and is a negative regulator of the Wnt signalling pathway. The protein encoded by this gene has a PDZ-domain binding motif in its C-terminus with which it interacts with the dishevelled protein. Dishevelled is a scaffold protein involved in the regulation of the Wnt signaling pathway. The Wnt signaling pathway plays an important role in embryonic development, tissue maintenance, and cancer progression. Mutations in this gene cause autosomal recessive, primary non-syndromic congenital hydrocephalus; a condition characterized by excessive accumulation of cerebrospinal fluid in the ventricles of the brain. [provided by RefSeq, Jan 2013]
Mouse(68339) coiled-coil domain containing 88C
Rat(362770) coiled-coil domain containing 88C
domestic guinea pig(100726024) coiled-coil domain containing 88C
naked mole-rat(101711088) coiled-coil domain containing 88C
sheep(101112005) coiled-coil domain containing 88C
Domestic Rabbit(100349859) coiled-coil domain containing 88C
chicken(423410) coiled-coil domain containing 88C
cow(515039) coiled-coil domain containing 88C
domestic cat(101086153) coiled-coil domain containing 88C
dog(480418) coiled-coil domain containing 88C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001080414 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080414 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080414 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026681 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026681 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026681 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU098441 MISSION® esiRNA esiRNA human CCDC88C (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080414 Rosetta Predictions human pricing
XM_029353 Rosetta Predictions human pricing
XM_935320 Rosetta Predictions human pricing
XM_935322 Rosetta Predictions human pricing
XM_935325 Rosetta Predictions human pricing
XM_935327 Rosetta Predictions human pricing
XM_935329 Rosetta Predictions human pricing
XM_935330 Rosetta Predictions human pricing
XM_001065209 Rosetta Predictions rat pricing
XM_343096 Rosetta Predictions rat pricing
NM_026681 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080414 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314616 predicted 4345
2 SASI_Hs02_00314617 predicted 1472
3 SASI_Hs02_00314618 predicted 4332
4 SASI_Hs02_00314619 predicted 4725
5 SASI_Hs02_00314620 predicted 1228
6 SASI_Hs02_00314621 predicted 1745
7 SASI_Hs02_00314622 predicted 3739
8 SASI_Hs02_00314623 predicted 4276
9 SASI_Hs02_00314624 predicted 2316
10 SASI_Hs02_00314625 predicted 1449
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_029353 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00263016 predicted 4790
2 SASI_Hs01_00263017 predicted 5144
3 SASI_Hs01_00263018 predicted 5168
4 SASI_Hs01_00263019 predicted 4779
5 SASI_Hs01_00263020 predicted 4793
6 SASI_Hs01_00263021 predicted 4825
7 SASI_Hs01_00263022 predicted 5080
8 SASI_Hs01_00263023 predicted 4824
9 SASI_Hs01_00263024 predicted 4810
10 SASI_Hs01_00263025 predicted 4811
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_935320 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00271404 predicted 408
2 SASI_Hs01_00271405 predicted 295
3 SASI_Hs01_00271406 predicted 360
4 SASI_Hs01_00271407 predicted 493
5 SASI_Hs01_00271408 predicted 283
6 SASI_Hs01_00271409 predicted 300
7 SASI_Hs01_00271410 predicted 302
8 SASI_Hs01_00271411 predicted 488
9 SASI_Hs01_00271412 predicted 375
10 SASI_Hs01_00271413 predicted 512
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_935322 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00297202 predicted 374
2 SASI_Hs01_00297203 predicted 841
3 SASI_Hs01_00297204 predicted 878
4 SASI_Hs01_00297205 predicted 268
5 SASI_Hs01_00297206 predicted 471
6 SASI_Hs01_00297207 predicted 721
7 SASI_Hs01_00297208 predicted 389
8 SASI_Hs01_00297209 predicted 453
9 SASI_Hs01_00297210 predicted 332
10 SASI_Hs01_00297211 predicted 306
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_935325 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00286478 predicted 1092
2 SASI_Hs01_00286479 predicted 1009
3 SASI_Hs01_00286480 predicted 1445
4 SASI_Hs01_00286481 predicted 1464
5 SASI_Hs01_00286482 predicted 999
6 SASI_Hs01_00286483 predicted 1075
7 SASI_Hs01_00286484 predicted 1100
8 SASI_Hs01_00286485 predicted 1128
9 SASI_Hs01_00286486 predicted 1375
10 SASI_Hs01_00286487 predicted 1114
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_935327 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00270897 predicted 882
2 SASI_Hs01_00270898 predicted 1364
3 SASI_Hs01_00270899 predicted 1427
4 SASI_Hs01_00270900 predicted 1471
5 SASI_Hs01_00270901 predicted 1578
6 SASI_Hs01_00270902 predicted 1570
7 SASI_Hs01_00270903 predicted 1511
8 SASI_Hs01_00270904 predicted 1704
9 SASI_Hs01_00270905 predicted 1555
10 SASI_Hs01_00270906 predicted 1332
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_935329 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00263346 predicted 1090
2 SASI_Hs01_00263347 predicted 1010
3 SASI_Hs01_00263348 predicted 1452
4 SASI_Hs01_00263349 predicted 1472
5 SASI_Hs01_00263350 predicted 1009
6 SASI_Hs01_00263351 predicted 1078
7 SASI_Hs01_00263352 predicted 1094
8 SASI_Hs01_00263353 predicted 1127
9 SASI_Hs01_00263354 predicted 1383
10 SASI_Hs01_00263355 predicted 1118
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_935330 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00293398 predicted 870
2 SASI_Hs01_00293399 predicted 896
3 SASI_Hs01_00293400 predicted 942
4 SASI_Hs01_00293401 predicted 805
5 SASI_Hs01_00293402 predicted 802
6 SASI_Hs01_00293403 predicted 867
7 SASI_Hs01_00293404 predicted 511
8 SASI_Hs01_00293405 predicted 2019
9 SASI_Hs01_00293406 predicted 2232
10 SASI_Hs01_00293407 predicted 2354
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065209 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00313257 predicted 5569
2 SASI_Rn02_00313258 predicted 3867
3 SASI_Rn02_00313259 predicted 1746
4 SASI_Rn02_00313260 predicted 334
5 SASI_Rn02_00313261 predicted 4968
6 SASI_Rn02_00313262 predicted 471
7 SASI_Rn02_00313263 predicted 5157
8 SASI_Rn02_00313264 predicted 2181
9 SASI_Rn02_00313265 predicted 3305
10 SASI_Rn02_00313266 predicted 4810
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343096 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00395313 predicted 5569
2 SASI_Rn02_00395314 predicted 3864
3 SASI_Rn02_00395315 predicted 1751
4 SASI_Rn02_00395316 predicted 336
5 SASI_Rn02_00395317 predicted 4965
6 SASI_Rn02_00395318 predicted 467
7 SASI_Rn02_00395319 predicted 5159
8 SASI_Rn02_00395320 predicted 2184
9 SASI_Rn02_00395321 predicted 3301
10 SASI_Rn02_00395322 predicted 4812
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026681 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00330716 predicted 1407
2 SASI_Mm01_00114045 predicted 330
3 SASI_Mm01_00114044 predicted 1663
4 SASI_Mm01_00114046 predicted 3763
5 SASI_Mm02_00330717 predicted 5060
6 SASI_Mm01_00114048 predicted 3358
7 SASI_Mm01_00114050 predicted 5289
8 SASI_Mm01_00114051 predicted 5211
9 SASI_Mm01_00114052 predicted 2297
10 SASI_Mm01_00114053 predicted 1032
11 SASI_Mm01_00114047 predicted 3113
12 SASI_Mm01_00114049 predicted 4774
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080414
CCDC88C MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 88C
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265600    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080414.2-6531s21c1
Sequence:CCGGCAATGTGTTGAGCTCCGTTAACTCGAGTTAACGGAGCTCAACACATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080414.2-3068s21c1
Sequence:CCGGCGAGCCTAAATCGCCAGTTAGCTCGAGCTAACTGGCGATTTAGGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080414.2-4359s21c1
Sequence:CCGGGGGTTCGAGGGAACGCTTAAACTCGAGTTTAAGCGTTCCCTCGAACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080414.2-3277s21c1
Sequence:CCGGATCGAGCTGGAGCGGAATAATCTCGAGATTATTCCGCTCCAGCTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080414.2-272s21c1
Sequence:CCGGCCACAAATCAACGCATCAATACTCGAGTATTGATGCGTTGATTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080414
CCDC88C MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 88C
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265600    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080414.2-6531s21c1
Sequence:CCGGCAATGTGTTGAGCTCCGTTAACTCGAGTTAACGGAGCTCAACACATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080414.2-3068s21c1
Sequence:CCGGCGAGCCTAAATCGCCAGTTAGCTCGAGCTAACTGGCGATTTAGGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080414.2-4359s21c1
Sequence:CCGGGGGTTCGAGGGAACGCTTAAACTCGAGTTTAAGCGTTCCCTCGAACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080414.2-3277s21c1
Sequence:CCGGATCGAGCTGGAGCGGAATAATCTCGAGATTATTCCGCTCCAGCTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080414.2-272s21c1
Sequence:CCGGCCACAAATCAACGCATCAATACTCGAGTATTGATGCGTTGATTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080414
CCDC88C MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 88C
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265600    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080414.2-6531s21c1
Sequence:CCGGCAATGTGTTGAGCTCCGTTAACTCGAGTTAACGGAGCTCAACACATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080414.2-3068s21c1
Sequence:CCGGCGAGCCTAAATCGCCAGTTAGCTCGAGCTAACTGGCGATTTAGGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080414.2-4359s21c1
Sequence:CCGGGGGTTCGAGGGAACGCTTAAACTCGAGTTTAAGCGTTCCCTCGAACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080414.2-3277s21c1
Sequence:CCGGATCGAGCTGGAGCGGAATAATCTCGAGATTATTCCGCTCCAGCTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080414.2-272s21c1
Sequence:CCGGCCACAAATCAACGCATCAATACTCGAGTATTGATGCGTTGATTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026681
CCDC88C MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 88C
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000216299    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026681.4-4229s1c1
Sequence:CCGGGCAGTACATAGACAAGTTAAACTCGAGTTTAACTTGTCTATGTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026681.4-4345s21c1
Sequence:CCGGGAGCCAAAGCCCTAGTCAAACCTCGAGGTTTGACTAGGGCTTTGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026681.4-4743s21c1
Sequence:CCGGGGCCGCACCAAAGGTTGTAATCTCGAGATTACAACCTTTGGTGCGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026681.4-3118s21c1
Sequence:CCGGAGATTGAGCTGCAGATGATAACTCGAGTTATCATCTGCAGCTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026681.4-428s21c1
Sequence:CCGGTCTCCAGCAGCTGATCGTAATCTCGAGATTACGATCAGCTGCTGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026681.4-4229s21c1
Sequence:CCGGGCAGTACATAGACAAGTTAAACTCGAGTTTAACTTGTCTATGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192823    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026681.3-441s1c1
Sequence:CCGGGATCGTAATGAATTTGCCCAACTCGAGTTGGGCAAATTCATTACGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192141    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026681.3-435s1c1
Sequence:CCGGGCAGCTGATCGTAATGAATTTCTCGAGAAATTCATTACGATCAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190721    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026681.3-271s1c1
Sequence:CCGGGATTTAGTGGACGGCATCTTTCTCGAGAAAGATGCCGTCCACTAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026681
CCDC88C MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 88C
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000216299    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026681.4-4229s1c1
Sequence:CCGGGCAGTACATAGACAAGTTAAACTCGAGTTTAACTTGTCTATGTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026681.4-4345s21c1
Sequence:CCGGGAGCCAAAGCCCTAGTCAAACCTCGAGGTTTGACTAGGGCTTTGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026681.4-4743s21c1
Sequence:CCGGGGCCGCACCAAAGGTTGTAATCTCGAGATTACAACCTTTGGTGCGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026681.4-3118s21c1
Sequence:CCGGAGATTGAGCTGCAGATGATAACTCGAGTTATCATCTGCAGCTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026681.4-428s21c1
Sequence:CCGGTCTCCAGCAGCTGATCGTAATCTCGAGATTACGATCAGCTGCTGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026681.4-4229s21c1
Sequence:CCGGGCAGTACATAGACAAGTTAAACTCGAGTTTAACTTGTCTATGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192823    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026681.3-441s1c1
Sequence:CCGGGATCGTAATGAATTTGCCCAACTCGAGTTGGGCAAATTCATTACGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192141    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026681.3-435s1c1
Sequence:CCGGGCAGCTGATCGTAATGAATTTCTCGAGAAATTCATTACGATCAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190721    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026681.3-271s1c1
Sequence:CCGGGATTTAGTGGACGGCATCTTTCTCGAGAAAGATGCCGTCCACTAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026681
CCDC88C MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 88C
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000216299    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026681.4-4229s1c1
Sequence:CCGGGCAGTACATAGACAAGTTAAACTCGAGTTTAACTTGTCTATGTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026681.4-4345s21c1
Sequence:CCGGGAGCCAAAGCCCTAGTCAAACCTCGAGGTTTGACTAGGGCTTTGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026681.4-4743s21c1
Sequence:CCGGGGCCGCACCAAAGGTTGTAATCTCGAGATTACAACCTTTGGTGCGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026681.4-3118s21c1
Sequence:CCGGAGATTGAGCTGCAGATGATAACTCGAGTTATCATCTGCAGCTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026681.4-428s21c1
Sequence:CCGGTCTCCAGCAGCTGATCGTAATCTCGAGATTACGATCAGCTGCTGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026681.4-4229s21c1
Sequence:CCGGGCAGTACATAGACAAGTTAAACTCGAGTTTAACTTGTCTATGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192823    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026681.3-441s1c1
Sequence:CCGGGATCGTAATGAATTTGCCCAACTCGAGTTGGGCAAATTCATTACGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192141    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026681.3-435s1c1
Sequence:CCGGGCAGCTGATCGTAATGAATTTCTCGAGAAATTCATTACGATCAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190721    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026681.3-271s1c1
Sequence:CCGGGATTTAGTGGACGGCATCTTTCTCGAGAAAGATGCCGTCCACTAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks