EMAIL THIS PAGE TO A FRIEND

CCDC89

coiled-coil domain containing 89

64 Gene Product Result for
UniProtKB ID: Q8N998
Gene ID:
Mouse(70054) coiled-coil domain containing 89
Rat(293107) coiled-coil domain containing 89
chicken(426393) coiled-coil domain containing 89
dog(476782) coiled-coil domain containing 89
cow(538595) coiled-coil domain containing 89
domestic cat(101097168) coiled-coil domain containing 89
sheep(101104101) coiled-coil domain containing 89
naked mole-rat(101725396) coiled-coil domain containing 89
domestic guinea pig(100729626) coiled-coil domain containing 89
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152723 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152723 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152723 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027298 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027298 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027298 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152723 Rosetta Predictions human pricing
NM_001134833 Rosetta Predictions rat pricing
XM_133591 Rosetta Predictions mouse pricing
XM_914003 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152723 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00125844 predicted 1319
2 SASI_Hs01_00125845 predicted 1331
3 SASI_Hs01_00125846 predicted 1292
4 SASI_Hs01_00125847 predicted 1294
5 SASI_Hs01_00125848 predicted 1253
6 SASI_Hs01_00125849 predicted 1322
7 SASI_Hs01_00125850 predicted 499
8 SASI_Hs01_00125852 predicted 490
9 SASI_Hs01_00125853 predicted 464
10 SASI_Hs02_00366627 predicted 537
11 SASI_Hs01_00125851 predicted 1278
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134833 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00258614 predicted 1418
2 SASI_Rn02_00258615 predicted 1402
3 SASI_Rn02_00258616 predicted 1181
4 SASI_Rn02_00258617 predicted 1290
5 SASI_Rn02_00258618 predicted 1381
6 SASI_Rn02_00258619 predicted 1393
7 SASI_Rn02_00258620 predicted 1210
8 SASI_Rn02_00258621 predicted 1124
9 SASI_Rn02_00258622 predicted 1344
10 SASI_Rn02_00258623 predicted 1015
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_133591 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00250286 predicted 1412
2 SASI_Mm01_00250287 predicted 1555
3 SASI_Mm01_00250288 predicted 529
4 SASI_Mm01_00250289 predicted 1656
5 SASI_Mm01_00250290 predicted 1297
6 SASI_Mm02_00424532 predicted 1617
7 SASI_Mm02_00424533 predicted 1377
8 SASI_Mm02_00424534 predicted 1513
9 SASI_Mm02_00424535 predicted 1358
10 SASI_Mm02_00424536 predicted 1128
11 SASI_Mm01_00250283 predicted 1874
12 SASI_Mm01_00250284 predicted 1794
13 SASI_Mm01_00250285 predicted 1793
14 SASI_Mm01_00250291 predicted 1603
15 SASI_Mm01_00250292 predicted 1459
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_914003 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00438213 predicted 1405
2 SASI_Mm02_00438214 predicted 1547
3 SASI_Mm02_00438215 predicted 531
4 SASI_Mm02_00438216 predicted 1649
5 SASI_Mm02_00438217 predicted 1290
6 SASI_Mm02_00438218 predicted 1613
7 SASI_Mm02_00438219 predicted 1384
8 SASI_Mm02_00438220 predicted 1507
9 SASI_Mm02_00438221 predicted 1358
10 SASI_Mm02_00438222 predicted 1126
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152723
CCDC89 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 89
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166621    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152723.1-1479s1c1
Sequence:CCGGCCAGATTTCCTTCTGTGCCTTCTCGAGAAGGCACAGAAGGAAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165162    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152723.1-555s1c1
Sequence:CCGGGCTCCGCTTCAAGGATGAATACTCGAGTATTCATCCTTGAAGCGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152723.1-951s1c1
Sequence:CCGGCACTAGAGAGAAAGAGGAGTTCTCGAGAACTCCTCTTTCTCTCTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163788    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152723.1-1054s1c1
Sequence:CCGGGCAAATGAAGACAGGAAGCATCTCGAGATGCTTCCTGTCTTCATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164856    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152723.1-421s1c1
Sequence:CCGGCAGATCCTAGAGCTGCTCAATCTCGAGATTGAGCAGCTCTAGGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165351    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152723.1-259s1c1
Sequence:CCGGGAGTTTAAGGAACTGGACGGTCTCGAGACCGTCCAGTTCCTTAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166068    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152723.1-1142s1c1
Sequence:CCGGGCAAAGTAGATGGGATCCAGACTCGAGTCTGGATCCCATCTACTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152723.1-340s21c1
Sequence:CCGGATGCTTCGCTCCCGCATTGAACTCGAGTTCAATGCGGGAGCGAAGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152723.1-507s21c1
Sequence:CCCGGAAACTAGAGGAACGCTTTATCTCGAGATAAAGCGTTCCTCTAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421591    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152723.1-1670s21c1
Sequence:CCGGTGTAGATAGTTAGGCTTATAGCTCGAGCTATAAGCCTAACTATCTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152723
CCDC89 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 89
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166621    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152723.1-1479s1c1
Sequence:CCGGCCAGATTTCCTTCTGTGCCTTCTCGAGAAGGCACAGAAGGAAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165162    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152723.1-555s1c1
Sequence:CCGGGCTCCGCTTCAAGGATGAATACTCGAGTATTCATCCTTGAAGCGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152723.1-951s1c1
Sequence:CCGGCACTAGAGAGAAAGAGGAGTTCTCGAGAACTCCTCTTTCTCTCTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163788    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152723.1-1054s1c1
Sequence:CCGGGCAAATGAAGACAGGAAGCATCTCGAGATGCTTCCTGTCTTCATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164856    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152723.1-421s1c1
Sequence:CCGGCAGATCCTAGAGCTGCTCAATCTCGAGATTGAGCAGCTCTAGGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165351    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152723.1-259s1c1
Sequence:CCGGGAGTTTAAGGAACTGGACGGTCTCGAGACCGTCCAGTTCCTTAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166068    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152723.1-1142s1c1
Sequence:CCGGGCAAAGTAGATGGGATCCAGACTCGAGTCTGGATCCCATCTACTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152723.1-340s21c1
Sequence:CCGGATGCTTCGCTCCCGCATTGAACTCGAGTTCAATGCGGGAGCGAAGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152723.1-507s21c1
Sequence:CCCGGAAACTAGAGGAACGCTTTATCTCGAGATAAAGCGTTCCTCTAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421591    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152723.1-1670s21c1
Sequence:CCGGTGTAGATAGTTAGGCTTATAGCTCGAGCTATAAGCCTAACTATCTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152723
CCDC89 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 89
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166621    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152723.1-1479s1c1
Sequence:CCGGCCAGATTTCCTTCTGTGCCTTCTCGAGAAGGCACAGAAGGAAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165162    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152723.1-555s1c1
Sequence:CCGGGCTCCGCTTCAAGGATGAATACTCGAGTATTCATCCTTGAAGCGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152723.1-951s1c1
Sequence:CCGGCACTAGAGAGAAAGAGGAGTTCTCGAGAACTCCTCTTTCTCTCTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163788    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152723.1-1054s1c1
Sequence:CCGGGCAAATGAAGACAGGAAGCATCTCGAGATGCTTCCTGTCTTCATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164856    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152723.1-421s1c1
Sequence:CCGGCAGATCCTAGAGCTGCTCAATCTCGAGATTGAGCAGCTCTAGGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165351    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152723.1-259s1c1
Sequence:CCGGGAGTTTAAGGAACTGGACGGTCTCGAGACCGTCCAGTTCCTTAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166068    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152723.1-1142s1c1
Sequence:CCGGGCAAAGTAGATGGGATCCAGACTCGAGTCTGGATCCCATCTACTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152723.1-340s21c1
Sequence:CCGGATGCTTCGCTCCCGCATTGAACTCGAGTTCAATGCGGGAGCGAAGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152723.1-507s21c1
Sequence:CCCGGAAACTAGAGGAACGCTTTATCTCGAGATAAAGCGTTCCTCTAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421591    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152723.1-1670s21c1
Sequence:CCGGTGTAGATAGTTAGGCTTATAGCTCGAGCTATAAGCCTAACTATCTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027298
CCDC89 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 89
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000346361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027298.1-1264s21c1
Sequence:CCGGATGGGATCCAGAAAGCTTATGCTCGAGCATAAGCTTTCTGGATCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027298.1-652s21c1
Sequence:CCGGCCAACCACGAGCAGATGATTCCTCGAGGAATCATCTGCTCGTGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346435    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027298.1-1786s21c1
Sequence:CCGGCACTGTAGGTGGGCGTATAAACTCGAGTTTATACGCCCACCTACAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027298.1-1365s21c1
Sequence:CCGGCTCCGCCATCTCTTTCCATAACTCGAGTTATGGAAAGAGATGGCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027298.1-1338s21c1
Sequence:CCGGAGCAAAGAGAGAGAGCTTAATCTCGAGATTAAGCTCTCTCTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027298
CCDC89 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 89
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000346361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027298.1-1264s21c1
Sequence:CCGGATGGGATCCAGAAAGCTTATGCTCGAGCATAAGCTTTCTGGATCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027298.1-652s21c1
Sequence:CCGGCCAACCACGAGCAGATGATTCCTCGAGGAATCATCTGCTCGTGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346435    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027298.1-1786s21c1
Sequence:CCGGCACTGTAGGTGGGCGTATAAACTCGAGTTTATACGCCCACCTACAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027298.1-1365s21c1
Sequence:CCGGCTCCGCCATCTCTTTCCATAACTCGAGTTATGGAAAGAGATGGCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027298.1-1338s21c1
Sequence:CCGGAGCAAAGAGAGAGAGCTTAATCTCGAGATTAAGCTCTCTCTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027298
CCDC89 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 89
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000346361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027298.1-1264s21c1
Sequence:CCGGATGGGATCCAGAAAGCTTATGCTCGAGCATAAGCTTTCTGGATCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027298.1-652s21c1
Sequence:CCGGCCAACCACGAGCAGATGATTCCTCGAGGAATCATCTGCTCGTGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346435    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027298.1-1786s21c1
Sequence:CCGGCACTGTAGGTGGGCGTATAAACTCGAGTTTATACGCCCACCTACAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027298.1-1365s21c1
Sequence:CCGGCTCCGCCATCTCTTTCCATAACTCGAGTTATGGAAAGAGATGGCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027298.1-1338s21c1
Sequence:CCGGAGCAAAGAGAGAGAGCTTAATCTCGAGATTAAGCTCTCTCTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks