EMAIL THIS PAGE TO A FRIEND

CCDC8

coiled-coil domain containing 8

73 Gene Product Result for
Synonyms: 3M3 PPP1R20 p90
UniProtKB ID: Q9H0W5, Q8TB26
Gene ID:
Human(83987) Summary: This gene encodes a coiled-coil domain-containing protein. The encoded protein functions as a cofactor required for p53-mediated apoptosis following DNA damage, and may also play a role in growth through interactions with the cytoskeletal adaptor protein obscurin-like 1. Mutations in this gene are a cause of 3M syndrome-3 (3M3). [provided by RefSeq, Dec 2011]
Mouse(434130) coiled-coil domain containing 8
Rat(494320) coiled-coil domain containing 8
dog(484430) coiled-coil domain containing 8
domestic cat(101100854) coiled-coil domain containing 8
cow(616838) coiled-coil domain containing 8
Horse(100065813) coiled-coil domain containing 8
naked mole-rat(101696602) coiled-coil domain containing 8
domestic guinea pig(100725448) coiled-coil domain containing 8
sheep(101116079) coiled-coil domain containing 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032040 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032040 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032040 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001101535 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001101535 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001101535 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU154711 MISSION® esiRNA esiRNA human CCDC8 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032040 Rosetta Predictions human pricing
NM_001009533 Rosetta Predictions rat pricing
XM_001477278 Rosetta Predictions mouse pricing
XM_001480107 Rosetta Predictions mouse pricing
XM_001480113 Rosetta Predictions mouse pricing
XM_485872 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032040 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00116310 predicted 1855
2 SASI_Hs01_00116311 predicted 2029
3 SASI_Hs01_00116312 predicted 1767
4 SASI_Hs01_00116314 predicted 1554
5 SASI_Hs01_00116315 predicted 1933
6 SASI_Hs01_00116316 predicted 2186
7 SASI_Hs01_00116318 predicted 1175
8 SASI_Hs02_00359237 predicted 1560
9 SASI_Hs01_00116319 predicted 2005
10 SASI_Hs02_00359238 predicted 1881
11 SASI_Hs01_00116313 predicted 950
12 SASI_Hs01_00116317 predicted 1846
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009533 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00088933 predicted 2398
2 SASI_Rn01_00088934 predicted 1646
3 SASI_Rn01_00088936 predicted 829
4 SASI_Rn02_00199588 predicted 1118
5 SASI_Rn01_00088935 predicted 828
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001477278 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00394731 predicted 309
2 SASI_Mm02_00394732 predicted 566
3 SASI_Mm02_00394733 predicted 1252
4 SASI_Mm02_00394734 predicted 1564
5 SASI_Mm02_00394735 predicted 1134
6 SASI_Mm02_00394736 predicted 1493
7 SASI_Mm02_00394737 predicted 623
8 SASI_Mm02_00394738 predicted 1268
9 SASI_Mm02_00394739 predicted 1102
10 SASI_Mm02_00394740 predicted 302
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001480107 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00415067 predicted 312
2 SASI_Mm02_00415068 predicted 395
3 SASI_Mm02_00415069 predicted 388
4 SASI_Mm02_00415070 predicted 261
5 SASI_Mm02_00415071 predicted 227
6 SASI_Mm02_00415072 predicted 306
7 SASI_Mm02_00415073 predicted 389
8 SASI_Mm02_00415074 predicted 417
9 SASI_Mm02_00415075 predicted 291
10 SASI_Mm02_00415076 predicted 228
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001480113 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00415113 predicted 310
2 SASI_Mm02_00415114 predicted 388
3 SASI_Mm02_00415115 predicted 389
4 SASI_Mm02_00415116 predicted 267
5 SASI_Mm02_00415117 predicted 229
6 SASI_Mm02_00415118 predicted 304
7 SASI_Mm02_00415119 predicted 388
8 SASI_Mm02_00415120 predicted 425
9 SASI_Mm02_00415121 predicted 286
10 SASI_Mm02_00415122 predicted 222
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_485872 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00426732 predicted 307
2 SASI_Mm02_00426733 predicted 567
3 SASI_Mm02_00426734 predicted 800
4 SASI_Mm02_00426735 predicted 724
5 SASI_Mm02_00426736 predicted 1128
6 SASI_Mm02_00426737 predicted 1224
7 SASI_Mm02_00426738 predicted 616
8 SASI_Mm02_00426739 predicted 266
9 SASI_Mm02_00426740 predicted 1111
10 SASI_Mm02_00426741 predicted 303
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032040
VALIDATED
CCDC8 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 8
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183189    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032040.1-1985s1c1
Sequence:CCGGGTTACAGATAATCAAAGGGAACTCGAGTTCCCTTTGATTATCTGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180853    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032040.1-1211s1c1
Sequence:CCGGGAGAGTGAGGATGATGAGGAACTCGAGTTCCTCATCATCCTCACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149823    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032040.1-2498s1c1
Sequence:CCGGCCACCTAACAACCCTCTTTATCTCGAGATAAAGAGGGTTGTTAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243205    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032040.3-2573s21c1
Sequence:CCGGCACCTAACAACCCTCTTTATTCTCGAGAATAAAGAGGGTTGTTAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032040.3-1977s21c1
Sequence:CCGGGAGGTCACAGGGCACAGATAACTCGAGTTATCTGTGCCCTGTGACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032040.3-1743s21c1
Sequence:CCGGAGAGGCTGCAGATAGTCAAAGCTCGAGCTTTGACTATCTGCAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032040.3-2112s21c1
Sequence:CCGGAGCTGTCCAGGGTGCAGATAACTCGAGTTATCTGCACCCTGGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032040.3-2055s21c1
Sequence:CCGGAGAGGTTACAGATAATCAAAGCTCGAGCTTTGATTATCTGTAACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032040
VALIDATED
CCDC8 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 8
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183189    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032040.1-1985s1c1
Sequence:CCGGGTTACAGATAATCAAAGGGAACTCGAGTTCCCTTTGATTATCTGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180853    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032040.1-1211s1c1
Sequence:CCGGGAGAGTGAGGATGATGAGGAACTCGAGTTCCTCATCATCCTCACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149823    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032040.1-2498s1c1
Sequence:CCGGCCACCTAACAACCCTCTTTATCTCGAGATAAAGAGGGTTGTTAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243205    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032040.3-2573s21c1
Sequence:CCGGCACCTAACAACCCTCTTTATTCTCGAGAATAAAGAGGGTTGTTAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032040.3-1977s21c1
Sequence:CCGGGAGGTCACAGGGCACAGATAACTCGAGTTATCTGTGCCCTGTGACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032040.3-1743s21c1
Sequence:CCGGAGAGGCTGCAGATAGTCAAAGCTCGAGCTTTGACTATCTGCAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032040.3-2112s21c1
Sequence:CCGGAGCTGTCCAGGGTGCAGATAACTCGAGTTATCTGCACCCTGGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032040.3-2055s21c1
Sequence:CCGGAGAGGTTACAGATAATCAAAGCTCGAGCTTTGATTATCTGTAACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032040
VALIDATED
CCDC8 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 8
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183189    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032040.1-1985s1c1
Sequence:CCGGGTTACAGATAATCAAAGGGAACTCGAGTTCCCTTTGATTATCTGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180853    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032040.1-1211s1c1
Sequence:CCGGGAGAGTGAGGATGATGAGGAACTCGAGTTCCTCATCATCCTCACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149823    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032040.1-2498s1c1
Sequence:CCGGCCACCTAACAACCCTCTTTATCTCGAGATAAAGAGGGTTGTTAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243205    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032040.3-2573s21c1
Sequence:CCGGCACCTAACAACCCTCTTTATTCTCGAGAATAAAGAGGGTTGTTAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032040.3-1977s21c1
Sequence:CCGGGAGGTCACAGGGCACAGATAACTCGAGTTATCTGTGCCCTGTGACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032040.3-1743s21c1
Sequence:CCGGAGAGGCTGCAGATAGTCAAAGCTCGAGCTTTGACTATCTGCAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032040.3-2112s21c1
Sequence:CCGGAGCTGTCCAGGGTGCAGATAACTCGAGTTATCTGCACCCTGGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032040.3-2055s21c1
Sequence:CCGGAGAGGTTACAGATAATCAAAGCTCGAGCTTTGATTATCTGTAACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001101535
CCDC8 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 8
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000254636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101535.1-326s21c1
Sequence:CCGGTCGATACCTCCAAAGTCAAAGCTCGAGCTTTGACTTTGGAGGTATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101535.1-92s21c1
Sequence:CCGGCAACGAAGGAAGCTGAGTTTCCTCGAGGAAACTCAGCTTCCTTCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101535.1-1225s21c1
Sequence:CCGGGAGGCTGCAGCTAGTCCAATACTCGAGTATTGGACTAGCTGCAGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101535.1-1848s21c1
Sequence:CCGGTAGGGCCCAGAAACAGGTAAACTCGAGTTTACCTGTTTCTGGGCCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001101535
CCDC8 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 8
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000254636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101535.1-326s21c1
Sequence:CCGGTCGATACCTCCAAAGTCAAAGCTCGAGCTTTGACTTTGGAGGTATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101535.1-92s21c1
Sequence:CCGGCAACGAAGGAAGCTGAGTTTCCTCGAGGAAACTCAGCTTCCTTCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101535.1-1225s21c1
Sequence:CCGGGAGGCTGCAGCTAGTCCAATACTCGAGTATTGGACTAGCTGCAGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101535.1-1848s21c1
Sequence:CCGGTAGGGCCCAGAAACAGGTAAACTCGAGTTTACCTGTTTCTGGGCCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001101535
CCDC8 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 8
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000254636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101535.1-326s21c1
Sequence:CCGGTCGATACCTCCAAAGTCAAAGCTCGAGCTTTGACTTTGGAGGTATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101535.1-92s21c1
Sequence:CCGGCAACGAAGGAAGCTGAGTTTCCTCGAGGAAACTCAGCTTCCTTCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101535.1-1225s21c1
Sequence:CCGGGAGGCTGCAGCTAGTCCAATACTCGAGTATTGGACTAGCTGCAGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101535.1-1848s21c1
Sequence:CCGGTAGGGCCCAGAAACAGGTAAACTCGAGTTTACCTGTTTCTGGGCCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks