EMAIL THIS PAGE TO A FRIEND

CCDC90B

coiled-coil domain containing 90B

57 Gene Product Result for
Synonyms: MDS011 MDS025
UniProtKB ID: Q9GZT6, A8K8I4, B4E3L2, Q3B781, Q9GZU6
Gene ID:
Mouse(66365) coiled-coil domain containing 90B
Rat(308820) coiled-coil domain containing 90B
Zebrafish(100149897) coiled-coil domain containing 90B
cow(506046) coiled-coil domain containing 90B
domestic cat(101099653) coiled-coil domain containing 90B
dog(476785) coiled-coil domain containing 90B
chicken(419023) coiled-coil domain containing 90B
sheep(101105956) coiled-coil domain containing 90B
naked mole-rat(101716723) coiled-coil domain containing 90B
domestic guinea pig(100733314) coiled-coil domain containing 90B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025515 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025515 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025515 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021825 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021825 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021825 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021825 Rosetta Predictions human pricing
NM_001024885 Rosetta Predictions rat pricing
NM_025515 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021825 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00113312 predicted 725
2 SASI_Hs02_00355136 predicted 456
3 SASI_Hs02_00355137 predicted 598
4 SASI_Hs02_00355138 predicted 725
5 SASI_Hs01_00113307 predicted 915
6 SASI_Hs01_00113308 predicted 1027
7 SASI_Hs01_00113309 predicted 852
8 SASI_Hs01_00113310 predicted 1046
9 SASI_Hs01_00113311 predicted 806
10 SASI_Hs01_00113313 predicted 1037
11 SASI_Hs01_00113314 predicted 707
12 SASI_Hs01_00113315 predicted 516
13 SASI_Hs01_00113316 predicted 893
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024885 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00074646 predicted 650
2 SASI_Rn01_00074647 predicted 453
3 SASI_Rn02_00202778 predicted 942
4 SASI_Rn01_00074648 predicted 429
5 SASI_Rn01_00074649 predicted 828
6 SASI_Rn01_00074650 predicted 605
7 SASI_Rn01_00074651 predicted 1009
8 SASI_Rn01_00074652 predicted 393
9 SASI_Rn02_00202779 predicted 645
10 SASI_Rn01_00074653 predicted 763
11 SASI_Rn01_00074654 predicted 1126
12 SASI_Rn01_00074655 predicted 1134
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025515 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00328404 predicted 369
2 SASI_Mm01_00043978 predicted 239
3 SASI_Mm01_00043979 predicted 207
4 SASI_Mm01_00043980 predicted 512
5 SASI_Mm01_00043981 predicted 557
6 SASI_Mm01_00043982 predicted 489
7 SASI_Mm01_00043983 predicted 487
8 SASI_Mm01_00043985 predicted 533
9 SASI_Mm02_00328405 predicted 537
10 SASI_Mm01_00043987 predicted 489
11 SASI_Mm01_00043984 predicted 198
12 SASI_Mm01_00043986 predicted 415
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025515
VALIDATED
CCDC90B MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 90B
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000181653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025515.1-258s1c1
Sequence:CCGGGTATCAGTGCTAAGTACGCTACTCGAGTAGCGTACTTAGCACTGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025515.1-499s1c1
Sequence:CCGGCGGACAATAAGCTGGACATTACTCGAGTAATGTCCAGCTTATTGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177498    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025515.1-959s1c1
Sequence:CCGGCCTTATCCTCTGATAACTATACTCGAGTATAGTTATCAGAGGATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177003    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025515.1-1003s1c1
Sequence:CCGGGCTTTGTAAATGAAGTTGGATCTCGAGATCCAACTTCATTTACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025515.1-648s1c1
Sequence:CCGGGACACTGAAATCGCTTCCTTACTCGAGTAAGGAAGCGATTTCAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197960    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025515.1-944s1c1
Sequence:CCGGGCTTGATATAGAAGTCCTTATCTCGAGATAAGGACTTCTATATCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198303    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025515.1-579s1c1
Sequence:CCGGGCAACCAATGAATTTGCCAAACTCGAGTTTGGCAAATTCATTGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337564    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025515.3-1237s21c1
Sequence:CCGGCAAAGGGCTTGTGGACTAAATCTCGAGATTTAGTCCACAAGCCCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215774    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025515.2-119s1c1
Sequence:CCGGCCACAACTAAGTCAGATTATGCTCGAGCATAATCTGACTTAGTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217899    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025515.2-211s1c1
Sequence:CCGGGACTTGGAAACTCACGGATTTCTCGAGAAATCCGTGAGTTTCCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025515.3-866s21c1
Sequence:CCGGGTCGAATCAGAGCGGACAATACTCGAGTATTGTCCGCTCTGATTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025515.3-522s21c1
Sequence:CCGGTAGAAGACCAGTGGATATAACCTCGAGGTTATATCCACTGGTCTTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025515.3-1002s21c1
Sequence:CCGGTATTTCAGAGACCAGTAATAACTCGAGTTATTACTGGTCTCTGAAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025515.3-637s21c1
Sequence:CCGGGTATCAGTGCTAAGTACGCTACTCGAGTAGCGTACTTAGCACTGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025515
VALIDATED
CCDC90B MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 90B
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000181653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025515.1-258s1c1
Sequence:CCGGGTATCAGTGCTAAGTACGCTACTCGAGTAGCGTACTTAGCACTGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025515.1-499s1c1
Sequence:CCGGCGGACAATAAGCTGGACATTACTCGAGTAATGTCCAGCTTATTGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177498    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025515.1-959s1c1
Sequence:CCGGCCTTATCCTCTGATAACTATACTCGAGTATAGTTATCAGAGGATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177003    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025515.1-1003s1c1
Sequence:CCGGGCTTTGTAAATGAAGTTGGATCTCGAGATCCAACTTCATTTACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025515.1-648s1c1
Sequence:CCGGGACACTGAAATCGCTTCCTTACTCGAGTAAGGAAGCGATTTCAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197960    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025515.1-944s1c1
Sequence:CCGGGCTTGATATAGAAGTCCTTATCTCGAGATAAGGACTTCTATATCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198303    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025515.1-579s1c1
Sequence:CCGGGCAACCAATGAATTTGCCAAACTCGAGTTTGGCAAATTCATTGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337564    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025515.3-1237s21c1
Sequence:CCGGCAAAGGGCTTGTGGACTAAATCTCGAGATTTAGTCCACAAGCCCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215774    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025515.2-119s1c1
Sequence:CCGGCCACAACTAAGTCAGATTATGCTCGAGCATAATCTGACTTAGTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217899    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025515.2-211s1c1
Sequence:CCGGGACTTGGAAACTCACGGATTTCTCGAGAAATCCGTGAGTTTCCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025515.3-866s21c1
Sequence:CCGGGTCGAATCAGAGCGGACAATACTCGAGTATTGTCCGCTCTGATTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025515.3-522s21c1
Sequence:CCGGTAGAAGACCAGTGGATATAACCTCGAGGTTATATCCACTGGTCTTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025515.3-1002s21c1
Sequence:CCGGTATTTCAGAGACCAGTAATAACTCGAGTTATTACTGGTCTCTGAAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025515.3-637s21c1
Sequence:CCGGGTATCAGTGCTAAGTACGCTACTCGAGTAGCGTACTTAGCACTGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025515
VALIDATED
CCDC90B MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 90B
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000181653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025515.1-258s1c1
Sequence:CCGGGTATCAGTGCTAAGTACGCTACTCGAGTAGCGTACTTAGCACTGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025515.1-499s1c1
Sequence:CCGGCGGACAATAAGCTGGACATTACTCGAGTAATGTCCAGCTTATTGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177498    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025515.1-959s1c1
Sequence:CCGGCCTTATCCTCTGATAACTATACTCGAGTATAGTTATCAGAGGATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177003    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025515.1-1003s1c1
Sequence:CCGGGCTTTGTAAATGAAGTTGGATCTCGAGATCCAACTTCATTTACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025515.1-648s1c1
Sequence:CCGGGACACTGAAATCGCTTCCTTACTCGAGTAAGGAAGCGATTTCAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197960    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025515.1-944s1c1
Sequence:CCGGGCTTGATATAGAAGTCCTTATCTCGAGATAAGGACTTCTATATCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198303    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025515.1-579s1c1
Sequence:CCGGGCAACCAATGAATTTGCCAAACTCGAGTTTGGCAAATTCATTGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337564    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025515.3-1237s21c1
Sequence:CCGGCAAAGGGCTTGTGGACTAAATCTCGAGATTTAGTCCACAAGCCCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215774    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025515.2-119s1c1
Sequence:CCGGCCACAACTAAGTCAGATTATGCTCGAGCATAATCTGACTTAGTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217899    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025515.2-211s1c1
Sequence:CCGGGACTTGGAAACTCACGGATTTCTCGAGAAATCCGTGAGTTTCCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025515.3-866s21c1
Sequence:CCGGGTCGAATCAGAGCGGACAATACTCGAGTATTGTCCGCTCTGATTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025515.3-522s21c1
Sequence:CCGGTAGAAGACCAGTGGATATAACCTCGAGGTTATATCCACTGGTCTTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025515.3-1002s21c1
Sequence:CCGGTATTTCAGAGACCAGTAATAACTCGAGTTATTACTGGTCTCTGAAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025515.3-637s21c1
Sequence:CCGGGTATCAGTGCTAAGTACGCTACTCGAGTAGCGTACTTAGCACTGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021825
VALIDATED
CCDC90B MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 90B
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021825.3-1088s1c2
Sequence:CCGGCCTGGCAATAGCATTGGGATTCTCGAGAATCCCAATGCTATTGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021825.3-839s1c2
Sequence:CCGGCAGTCGAATCAGAGCAGATAACTCGAGTTATCTGCTCTGATTCGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_021825.3-973s1c1
Sequence:CCGGGTATTATTTCAGAGACCAGTACTCGAGTACTGGTCTCTGAAATAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021825.3-644s1c1
Sequence:CCGGCCTGGATACTATCTATAAAGACTCGAGTCTTTATAGATAGTATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_021825.3-839s1c1
Sequence:CCGGCAGTCGAATCAGAGCAGATAACTCGAGTTATCTGCTCTGATTCGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_021825.3-1088s1c1
Sequence:CCGGCCTGGCAATAGCATTGGGATTCTCGAGAATCCCAATGCTATTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115912    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_021825.3-1175s1c1
Sequence:CCGGCCGGGAGAGATTTACTTTGAACTCGAGTTCAAAGTAAATCTCTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021825.3-973s1c2
Sequence:CCGGGTATTATTTCAGAGACCAGTACTCGAGTACTGGTCTCTGAAATAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121860    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021825.3-1275s1c1
Sequence:CCGGGAGAAGAGATACTGTGTCTTTCTCGAGAAAGACACAGTATCTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_021825.3-973s21c1
Sequence:CCGGGTATTATTTCAGAGACCAGTACTCGAGTACTGGTCTCTGAAATAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_021825.3-1088s21c1
Sequence:CCGGCCTGGCAATAGCATTGGGATTCTCGAGAATCCCAATGCTATTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021825.3-839s21c1
Sequence:CCGGCAGTCGAATCAGAGCAGATAACTCGAGTTATCTGCTCTGATTCGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307952    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021825.3-1175s21c1
Sequence:CCGGCCGGGAGAGATTTACTTTGAACTCGAGTTCAAAGTAAATCTCTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021825
VALIDATED
CCDC90B MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 90B
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021825.3-1088s1c2
Sequence:CCGGCCTGGCAATAGCATTGGGATTCTCGAGAATCCCAATGCTATTGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021825.3-839s1c2
Sequence:CCGGCAGTCGAATCAGAGCAGATAACTCGAGTTATCTGCTCTGATTCGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_021825.3-973s1c1
Sequence:CCGGGTATTATTTCAGAGACCAGTACTCGAGTACTGGTCTCTGAAATAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021825.3-644s1c1
Sequence:CCGGCCTGGATACTATCTATAAAGACTCGAGTCTTTATAGATAGTATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_021825.3-839s1c1
Sequence:CCGGCAGTCGAATCAGAGCAGATAACTCGAGTTATCTGCTCTGATTCGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_021825.3-1088s1c1
Sequence:CCGGCCTGGCAATAGCATTGGGATTCTCGAGAATCCCAATGCTATTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115912    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_021825.3-1175s1c1
Sequence:CCGGCCGGGAGAGATTTACTTTGAACTCGAGTTCAAAGTAAATCTCTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021825.3-973s1c2
Sequence:CCGGGTATTATTTCAGAGACCAGTACTCGAGTACTGGTCTCTGAAATAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121860    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021825.3-1275s1c1
Sequence:CCGGGAGAAGAGATACTGTGTCTTTCTCGAGAAAGACACAGTATCTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_021825.3-973s21c1
Sequence:CCGGGTATTATTTCAGAGACCAGTACTCGAGTACTGGTCTCTGAAATAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_021825.3-1088s21c1
Sequence:CCGGCCTGGCAATAGCATTGGGATTCTCGAGAATCCCAATGCTATTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021825.3-839s21c1
Sequence:CCGGCAGTCGAATCAGAGCAGATAACTCGAGTTATCTGCTCTGATTCGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307952    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021825.3-1175s21c1
Sequence:CCGGCCGGGAGAGATTTACTTTGAACTCGAGTTCAAAGTAAATCTCTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021825
VALIDATED
CCDC90B MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 90B
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021825.3-1088s1c2
Sequence:CCGGCCTGGCAATAGCATTGGGATTCTCGAGAATCCCAATGCTATTGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021825.3-839s1c2
Sequence:CCGGCAGTCGAATCAGAGCAGATAACTCGAGTTATCTGCTCTGATTCGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_021825.3-973s1c1
Sequence:CCGGGTATTATTTCAGAGACCAGTACTCGAGTACTGGTCTCTGAAATAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021825.3-644s1c1
Sequence:CCGGCCTGGATACTATCTATAAAGACTCGAGTCTTTATAGATAGTATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_021825.3-839s1c1
Sequence:CCGGCAGTCGAATCAGAGCAGATAACTCGAGTTATCTGCTCTGATTCGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_021825.3-1088s1c1
Sequence:CCGGCCTGGCAATAGCATTGGGATTCTCGAGAATCCCAATGCTATTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115912    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_021825.3-1175s1c1
Sequence:CCGGCCGGGAGAGATTTACTTTGAACTCGAGTTCAAAGTAAATCTCTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021825.3-973s1c2
Sequence:CCGGGTATTATTTCAGAGACCAGTACTCGAGTACTGGTCTCTGAAATAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121860    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021825.3-1275s1c1
Sequence:CCGGGAGAAGAGATACTGTGTCTTTCTCGAGAAAGACACAGTATCTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_021825.3-973s21c1
Sequence:CCGGGTATTATTTCAGAGACCAGTACTCGAGTACTGGTCTCTGAAATAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_021825.3-1088s21c1
Sequence:CCGGCCTGGCAATAGCATTGGGATTCTCGAGAATCCCAATGCTATTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021825.3-839s21c1
Sequence:CCGGCAGTCGAATCAGAGCAGATAACTCGAGTTATCTGCTCTGATTCGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307952    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021825.3-1175s21c1
Sequence:CCGGCCGGGAGAGATTTACTTTGAACTCGAGTTCAAAGTAAATCTCTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks