EMAIL THIS PAGE TO A FRIEND

CCDC91

coiled-coil domain containing 91

100 Gene Product Result for
Synonyms: p56
Gene ID:
Mouse(67015) coiled-coil domain containing 91
Rat(312863) coiled-coil domain containing 91
domestic guinea pig(100734145) coiled-coil domain containing 91
naked mole-rat(101701535) coiled-coil domain containing 91
sheep(101109260) coiled-coil domain containing 91
chicken(419045) coiled-coil domain containing 91
cow(530230) coiled-coil domain containing 91
Horse(100064764) coiled-coil domain containing 91
dog(486622) coiled-coil domain containing 91
domestic cat(101083777) coiled-coil domain containing 91
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018318 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018318 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018318 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025911 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025911 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025911 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018318 Rosetta Predictions human pricing
NM_001014061 Rosetta Predictions rat pricing
NM_025911 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018318 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00351743 predicted 295
2 SASI_Hs01_00011398 predicted 285
3 SASI_Hs01_00011399 predicted 747
4 SASI_Hs01_00011401 predicted 1194
5 SASI_Hs01_00011402 predicted 1198
6 SASI_Hs01_00011404 predicted 742
7 SASI_Hs01_00011405 predicted 788
8 SASI_Hs01_00011406 predicted 913
9 SASI_Hs01_00011407 predicted 424
10 SASI_Hs02_00351744 predicted 222
11 SASI_Hs01_00011400 predicted 358
12 SASI_Hs01_00011403 predicted 647
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014061 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00067846 predicted 204
2 SASI_Rn01_00067847 predicted 1160
3 SASI_Rn01_00067848 predicted 1101
4 SASI_Rn01_00067849 predicted 1035
5 SASI_Rn01_00067850 predicted 403
6 SASI_Rn01_00067851 predicted 887
7 SASI_Rn01_00067853 predicted 586
8 SASI_Rn01_00067854 predicted 795
9 SASI_Rn01_00067855 predicted 1482
10 SASI_Rn02_00201457 predicted 836
11 SASI_Rn01_00067852 predicted 475
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025911 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00037273 predicted 486
2 SASI_Mm01_00037274 predicted 1193
3 SASI_Mm01_00037275 predicted 501
4 SASI_Mm01_00037277 predicted 1142
5 SASI_Mm01_00037279 predicted 900
6 SASI_Mm01_00037280 predicted 1511
7 SASI_Mm01_00037281 predicted 1157
8 SASI_Mm01_00037282 predicted 1305
9 SASI_Mm02_00329267 predicted 830
10 SASI_Mm02_00329268 predicted 1025
11 SASI_Mm01_00037276 predicted 1226
12 SASI_Mm01_00037278 predicted 1094
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018318
VALIDATED
CCDC91 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 91
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000330629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018318.3-87s21c1
Sequence:CCGGCAACATCTCCTGCTATTCCTTCTCGAGAAGGAATAGCAGGAGATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330632    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018318.3-1641s21c1
Sequence:CCGGTAGCCTGTGGGAGTCTATTATCTCGAGATAATAGACTCCCACAGGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_018318.3-132s21c1
Sequence:CCGGGAGTCCATCTTTCACCATCTTCTCGAGAAGATGGTGAAAGATGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_018318.3-1142s21c1
Sequence:CCGGGAAGAGCAGAAACGAAGTGAACTCGAGTTCACTTCGTTTCTGCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_018318.2-1142s1c1
Sequence:CCGGGAAGAGCAGAAACGAAGTGAACTCGAGTTCACTTCGTTTCTGCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130719    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018318.2-69s1c1
Sequence:CCGGGAAGTGGTGAAACCCAAACAACTCGAGTTGTTTGGGTTTCACCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_018318.2-87s1c1
Sequence:CCGGCAACATCTCCTGCTATTCCTTCTCGAGAAGGAATAGCAGGAGATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_018318.2-132s1c1
Sequence:CCGGGAGTCCATCTTTCACCATCTTCTCGAGAAGATGGTGAAAGATGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018318.2-228s1c1
Sequence:CCGGCAGAGAATACACATGCAGCAACTCGAGTTGCTGCATGTGTATTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_018318.2-656s1c1
Sequence:CCGGGTGGATGAATATAAGGCACTACTCGAGTAGTGCCTTATATTCATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018318
VALIDATED
CCDC91 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 91
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000330629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018318.3-87s21c1
Sequence:CCGGCAACATCTCCTGCTATTCCTTCTCGAGAAGGAATAGCAGGAGATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330632    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018318.3-1641s21c1
Sequence:CCGGTAGCCTGTGGGAGTCTATTATCTCGAGATAATAGACTCCCACAGGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_018318.3-132s21c1
Sequence:CCGGGAGTCCATCTTTCACCATCTTCTCGAGAAGATGGTGAAAGATGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_018318.3-1142s21c1
Sequence:CCGGGAAGAGCAGAAACGAAGTGAACTCGAGTTCACTTCGTTTCTGCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_018318.2-1142s1c1
Sequence:CCGGGAAGAGCAGAAACGAAGTGAACTCGAGTTCACTTCGTTTCTGCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130719    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018318.2-69s1c1
Sequence:CCGGGAAGTGGTGAAACCCAAACAACTCGAGTTGTTTGGGTTTCACCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_018318.2-87s1c1
Sequence:CCGGCAACATCTCCTGCTATTCCTTCTCGAGAAGGAATAGCAGGAGATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_018318.2-132s1c1
Sequence:CCGGGAGTCCATCTTTCACCATCTTCTCGAGAAGATGGTGAAAGATGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018318.2-228s1c1
Sequence:CCGGCAGAGAATACACATGCAGCAACTCGAGTTGCTGCATGTGTATTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_018318.2-656s1c1
Sequence:CCGGGTGGATGAATATAAGGCACTACTCGAGTAGTGCCTTATATTCATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018318
VALIDATED
CCDC91 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 91
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000330629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018318.3-87s21c1
Sequence:CCGGCAACATCTCCTGCTATTCCTTCTCGAGAAGGAATAGCAGGAGATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330632    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018318.3-1641s21c1
Sequence:CCGGTAGCCTGTGGGAGTCTATTATCTCGAGATAATAGACTCCCACAGGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_018318.3-132s21c1
Sequence:CCGGGAGTCCATCTTTCACCATCTTCTCGAGAAGATGGTGAAAGATGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_018318.3-1142s21c1
Sequence:CCGGGAAGAGCAGAAACGAAGTGAACTCGAGTTCACTTCGTTTCTGCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_018318.2-1142s1c1
Sequence:CCGGGAAGAGCAGAAACGAAGTGAACTCGAGTTCACTTCGTTTCTGCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130719    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018318.2-69s1c1
Sequence:CCGGGAAGTGGTGAAACCCAAACAACTCGAGTTGTTTGGGTTTCACCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_018318.2-87s1c1
Sequence:CCGGCAACATCTCCTGCTATTCCTTCTCGAGAAGGAATAGCAGGAGATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_018318.2-132s1c1
Sequence:CCGGGAGTCCATCTTTCACCATCTTCTCGAGAAGATGGTGAAAGATGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018318.2-228s1c1
Sequence:CCGGCAGAGAATACACATGCAGCAACTCGAGTTGCTGCATGTGTATTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_018318.2-656s1c1
Sequence:CCGGGTGGATGAATATAAGGCACTACTCGAGTAGTGCCTTATATTCATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025911
VALIDATED
CCDC91 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 91
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000287964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025911.2-831s21c1
Sequence:CCGGGCGCTGAGCATTATAGTGGATCTCGAGATCCACTATAATGCTCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025911.2-905s21c1
Sequence:CCGGGAAGCAATATGTGTCTGCAATCTCGAGATTGCAGACACATATTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287962    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025911.2-1804s21c1
Sequence:CCGGCGGATCTAACTCTCTGCTATTCTCGAGAATAGCAGAGAGTTAGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025911.2-1196s21c1
Sequence:CCGGGAAAGTTCATGCCGAAGAAAGCTCGAGCTTTCTTCGGCATGAACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025911.2-619s21c1
Sequence:CCGGTATCAAGTCTGGAGACTAAACCTCGAGGTTTAGTCTCCAGACTTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126334    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025911.2-1804s1c1
Sequence:CCGGCGGATCTAACTCTCTGCTATTCTCGAGAATAGCAGAGAGTTAGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025911.2-1144s1c1
Sequence:CCGGCAATGAAAGATGTCATCACTACTCGAGTAGTGATGACATCTTTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025911.2-494s1c1
Sequence:CCGGACATCTGAACATCCCTCTCTTCTCGAGAAGAGAGGGATGTTCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025911.2-905s1c1
Sequence:CCGGGAAGCAATATGTGTCTGCAATCTCGAGATTGCAGACACATATTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025911.2-831s1c1
Sequence:CCGGGCGCTGAGCATTATAGTGGATCTCGAGATCCACTATAATGCTCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025911
VALIDATED
CCDC91 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 91
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000287964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025911.2-831s21c1
Sequence:CCGGGCGCTGAGCATTATAGTGGATCTCGAGATCCACTATAATGCTCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025911.2-905s21c1
Sequence:CCGGGAAGCAATATGTGTCTGCAATCTCGAGATTGCAGACACATATTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287962    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025911.2-1804s21c1
Sequence:CCGGCGGATCTAACTCTCTGCTATTCTCGAGAATAGCAGAGAGTTAGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025911.2-1196s21c1
Sequence:CCGGGAAAGTTCATGCCGAAGAAAGCTCGAGCTTTCTTCGGCATGAACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025911.2-619s21c1
Sequence:CCGGTATCAAGTCTGGAGACTAAACCTCGAGGTTTAGTCTCCAGACTTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126334    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025911.2-1804s1c1
Sequence:CCGGCGGATCTAACTCTCTGCTATTCTCGAGAATAGCAGAGAGTTAGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025911.2-1144s1c1
Sequence:CCGGCAATGAAAGATGTCATCACTACTCGAGTAGTGATGACATCTTTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025911.2-494s1c1
Sequence:CCGGACATCTGAACATCCCTCTCTTCTCGAGAAGAGAGGGATGTTCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025911.2-905s1c1
Sequence:CCGGGAAGCAATATGTGTCTGCAATCTCGAGATTGCAGACACATATTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025911.2-831s1c1
Sequence:CCGGGCGCTGAGCATTATAGTGGATCTCGAGATCCACTATAATGCTCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025911
VALIDATED
CCDC91 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 91
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000287964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025911.2-831s21c1
Sequence:CCGGGCGCTGAGCATTATAGTGGATCTCGAGATCCACTATAATGCTCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025911.2-905s21c1
Sequence:CCGGGAAGCAATATGTGTCTGCAATCTCGAGATTGCAGACACATATTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287962    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025911.2-1804s21c1
Sequence:CCGGCGGATCTAACTCTCTGCTATTCTCGAGAATAGCAGAGAGTTAGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025911.2-1196s21c1
Sequence:CCGGGAAAGTTCATGCCGAAGAAAGCTCGAGCTTTCTTCGGCATGAACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025911.2-619s21c1
Sequence:CCGGTATCAAGTCTGGAGACTAAACCTCGAGGTTTAGTCTCCAGACTTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126334    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025911.2-1804s1c1
Sequence:CCGGCGGATCTAACTCTCTGCTATTCTCGAGAATAGCAGAGAGTTAGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025911.2-1144s1c1
Sequence:CCGGCAATGAAAGATGTCATCACTACTCGAGTAGTGATGACATCTTTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025911.2-494s1c1
Sequence:CCGGACATCTGAACATCCCTCTCTTCTCGAGAAGAGAGGGATGTTCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025911.2-905s1c1
Sequence:CCGGGAAGCAATATGTGTCTGCAATCTCGAGATTGCAGACACATATTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025911.2-831s1c1
Sequence:CCGGGCGCTGAGCATTATAGTGGATCTCGAGATCCACTATAATGCTCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks