EMAIL THIS PAGE TO A FRIEND

CCDC92

coiled-coil domain containing 92

63 Gene Product Result for
UniProtKB ID: Q53HC0, Q9H697
Gene ID:
Mouse(215707) coiled-coil domain containing 92
Rat(100036765) coiled-coil domain containing 92
Zebrafish(571995) coiled-coil domain containing 92
dog(477444) coiled-coil domain containing 92
cow(615530) coiled-coil domain containing 92
domestic cat(101084488) coiled-coil domain containing 92
chicken(416817) coiled-coil domain containing 92
sheep(101116427) coiled-coil domain containing 92
naked mole-rat(101701227) coiled-coil domain containing 92
domestic guinea pig(100733567) coiled-coil domain containing 92
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025140 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025140 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025140 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144819 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144819 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144819 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025140 Rosetta Predictions human pricing
NM_001083898 Rosetta Predictions rat pricing
NM_144819 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025140 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00051168 predicted 1312
2 SASI_Hs01_00051169 predicted 1173
3 SASI_Hs01_00051170 predicted 508
4 SASI_Hs01_00051171 predicted 1495
5 SASI_Hs02_00357866 predicted 1114
6 SASI_Hs01_00051172 predicted 1355
7 SASI_Hs01_00051173 predicted 1495
8 SASI_Hs02_00357867 predicted 1498
9 SASI_Hs01_00051174 predicted 212
10 SASI_Hs01_00051175 predicted 233
11 SASI_Hs01_00051176 predicted 564
12 SASI_Hs01_00051177 predicted 1466
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083898 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00208919 predicted 1113
2 SASI_Rn02_00208920 predicted 241
3 SASI_Rn02_00208921 predicted 485
4 SASI_Rn02_00208922 predicted 1027
5 SASI_Rn02_00208923 predicted 264
6 SASI_Rn02_00208924 predicted 280
7 SASI_Rn02_00208925 predicted 1125
8 SASI_Rn02_00208926 predicted 1139
9 SASI_Rn02_00208927 predicted 1036
10 SASI_Rn02_00208928 predicted 950
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144819 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00193451 predicted 964
2 SASI_Mm01_00193452 predicted 1134
3 SASI_Mm01_00193453 predicted 1208
4 SASI_Mm01_00193454 predicted 1119
5 SASI_Mm02_00340187 predicted 350
6 SASI_Mm01_00193456 predicted 339
7 SASI_Mm01_00193457 predicted 1200
8 SASI_Mm02_00340188 predicted 251
9 SASI_Mm01_00193459 predicted 1293
10 SASI_Mm02_00340189 predicted 223
11 SASI_Mm01_00193450 predicted 322
12 SASI_Mm01_00193455 predicted 1329
13 SASI_Mm01_00193458 predicted 303
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025140
VALIDATED
CCDC92 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 92
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138577    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025140.1-1458s1c1
Sequence:CCGGCCACACAGTCACACACCTAATCTCGAGATTAGGTGTGTGACTGTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025140.1-824s1c1
Sequence:CCGGCAGAGAGCAGGAAACTCCTTTCTCGAGAAAGGAGTTTCCTGCTCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137451    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025140.1-1660s1c1
Sequence:CCGGGCGTGTATCTCAAGGAACTAACTCGAGTTAGTTCCTTGAGATACACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133731    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025140.1-1661s1c1
Sequence:CCGGCGTGTATCTCAAGGAACTAAACTCGAGTTTAGTTCCTTGAGATACACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134049    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025140.1-430s1c1
Sequence:CCGGCTGAAAGTGAAAGAGAACGAACTCGAGTTCGTTCTCTTTCACTTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025140.1-426s1c1
Sequence:CCGGCCAACTGAAAGTGAAAGAGAACTCGAGTTCTCTTTCACTTTCAGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025140.1-238s1c1
Sequence:CCGGCAGAAGAACCTCCTGTTCCTTCTCGAGAAGGAACAGGAGGTTCTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025140.1-367s21c1
Sequence:CCGGACAGGAGACGGGACTTCTAAACTCGAGTTTAGAAGTCCCGTCTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353704    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025140.1-1458s21c1
Sequence:CCGGCCACACAGTCACACACCTAATCTCGAGATTAGGTGTGTGACTGTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025140.1-824s21c1
Sequence:CCGGCAGAGAGCAGGAAACTCCTTTCTCGAGAAAGGAGTTTCCTGCTCTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025140.1-799s21c1
Sequence:CCGGTTTGAAGAGGTCTACAGATTCCTCGAGGAATCTGTAGACCTCTTCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025140.1-315s21c1
Sequence:CCGGGCAGCACTGCACAGATTTAACCTCGAGGTTAAATCTGTGCAGTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025140
VALIDATED
CCDC92 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 92
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138577    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025140.1-1458s1c1
Sequence:CCGGCCACACAGTCACACACCTAATCTCGAGATTAGGTGTGTGACTGTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025140.1-824s1c1
Sequence:CCGGCAGAGAGCAGGAAACTCCTTTCTCGAGAAAGGAGTTTCCTGCTCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137451    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025140.1-1660s1c1
Sequence:CCGGGCGTGTATCTCAAGGAACTAACTCGAGTTAGTTCCTTGAGATACACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133731    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025140.1-1661s1c1
Sequence:CCGGCGTGTATCTCAAGGAACTAAACTCGAGTTTAGTTCCTTGAGATACACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134049    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025140.1-430s1c1
Sequence:CCGGCTGAAAGTGAAAGAGAACGAACTCGAGTTCGTTCTCTTTCACTTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025140.1-426s1c1
Sequence:CCGGCCAACTGAAAGTGAAAGAGAACTCGAGTTCTCTTTCACTTTCAGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025140.1-238s1c1
Sequence:CCGGCAGAAGAACCTCCTGTTCCTTCTCGAGAAGGAACAGGAGGTTCTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025140.1-367s21c1
Sequence:CCGGACAGGAGACGGGACTTCTAAACTCGAGTTTAGAAGTCCCGTCTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353704    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025140.1-1458s21c1
Sequence:CCGGCCACACAGTCACACACCTAATCTCGAGATTAGGTGTGTGACTGTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025140.1-824s21c1
Sequence:CCGGCAGAGAGCAGGAAACTCCTTTCTCGAGAAAGGAGTTTCCTGCTCTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025140.1-799s21c1
Sequence:CCGGTTTGAAGAGGTCTACAGATTCCTCGAGGAATCTGTAGACCTCTTCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025140.1-315s21c1
Sequence:CCGGGCAGCACTGCACAGATTTAACCTCGAGGTTAAATCTGTGCAGTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025140
VALIDATED
CCDC92 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 92
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138577    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025140.1-1458s1c1
Sequence:CCGGCCACACAGTCACACACCTAATCTCGAGATTAGGTGTGTGACTGTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025140.1-824s1c1
Sequence:CCGGCAGAGAGCAGGAAACTCCTTTCTCGAGAAAGGAGTTTCCTGCTCTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137451    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025140.1-1660s1c1
Sequence:CCGGGCGTGTATCTCAAGGAACTAACTCGAGTTAGTTCCTTGAGATACACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133731    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025140.1-1661s1c1
Sequence:CCGGCGTGTATCTCAAGGAACTAAACTCGAGTTTAGTTCCTTGAGATACACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134049    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025140.1-430s1c1
Sequence:CCGGCTGAAAGTGAAAGAGAACGAACTCGAGTTCGTTCTCTTTCACTTTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025140.1-426s1c1
Sequence:CCGGCCAACTGAAAGTGAAAGAGAACTCGAGTTCTCTTTCACTTTCAGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025140.1-238s1c1
Sequence:CCGGCAGAAGAACCTCCTGTTCCTTCTCGAGAAGGAACAGGAGGTTCTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025140.1-367s21c1
Sequence:CCGGACAGGAGACGGGACTTCTAAACTCGAGTTTAGAAGTCCCGTCTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353704    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025140.1-1458s21c1
Sequence:CCGGCCACACAGTCACACACCTAATCTCGAGATTAGGTGTGTGACTGTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025140.1-824s21c1
Sequence:CCGGCAGAGAGCAGGAAACTCCTTTCTCGAGAAAGGAGTTTCCTGCTCTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025140.1-799s21c1
Sequence:CCGGTTTGAAGAGGTCTACAGATTCCTCGAGGAATCTGTAGACCTCTTCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025140.1-315s21c1
Sequence:CCGGGCAGCACTGCACAGATTTAACCTCGAGGTTAAATCTGTGCAGTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144819
VALIDATED
CCDC92 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 92
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144819.1-961s1c1
Sequence:CCGGGATAAGCCACACAAGACGCATCTCGAGATGCGTCTTGTGTGGCTTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_144819.1-289s1c1
Sequence:CCGGCACTGCACAGATCTAACATATCTCGAGATATGTTAGATCTGTGCAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_144819.1-298s1c1
Sequence:CCGGGATCTAACATATGAGCTGACACTCGAGTGTCAGCTCATATGTTAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200181    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144819.1-517s1c1
Sequence:CCGGCTGAAGGTGAAGAGCCACAAACTCGAGTTTGTGGCTCTTCACCTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182408    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144819.1-525s1c1
Sequence:CCGGGAAGAGCCACAAACTGAGCATCTCGAGATGCTCAGTTTGTGGCTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177564    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_144819.1-1386s1c1
Sequence:CCGGCTAGAATATGAATCGCCTGAACTCGAGTTCAGGCGATTCATATTCTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144819.1-294s1c1
Sequence:CCGGCACAGATCTAACATATGAGCTCTCGAGAGCTCATATGTTAGATCTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216038    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144819.2-1630s1c1
Sequence:CCGGCTGATTGTGTGTTCATAATTTCTCGAGAAATTATGAACACACAATCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144819
VALIDATED
CCDC92 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 92
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144819.1-961s1c1
Sequence:CCGGGATAAGCCACACAAGACGCATCTCGAGATGCGTCTTGTGTGGCTTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_144819.1-289s1c1
Sequence:CCGGCACTGCACAGATCTAACATATCTCGAGATATGTTAGATCTGTGCAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_144819.1-298s1c1
Sequence:CCGGGATCTAACATATGAGCTGACACTCGAGTGTCAGCTCATATGTTAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200181    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144819.1-517s1c1
Sequence:CCGGCTGAAGGTGAAGAGCCACAAACTCGAGTTTGTGGCTCTTCACCTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182408    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144819.1-525s1c1
Sequence:CCGGGAAGAGCCACAAACTGAGCATCTCGAGATGCTCAGTTTGTGGCTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177564    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_144819.1-1386s1c1
Sequence:CCGGCTAGAATATGAATCGCCTGAACTCGAGTTCAGGCGATTCATATTCTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144819.1-294s1c1
Sequence:CCGGCACAGATCTAACATATGAGCTCTCGAGAGCTCATATGTTAGATCTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216038    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144819.2-1630s1c1
Sequence:CCGGCTGATTGTGTGTTCATAATTTCTCGAGAAATTATGAACACACAATCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144819
VALIDATED
CCDC92 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 92
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144819.1-961s1c1
Sequence:CCGGGATAAGCCACACAAGACGCATCTCGAGATGCGTCTTGTGTGGCTTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_144819.1-289s1c1
Sequence:CCGGCACTGCACAGATCTAACATATCTCGAGATATGTTAGATCTGTGCAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_144819.1-298s1c1
Sequence:CCGGGATCTAACATATGAGCTGACACTCGAGTGTCAGCTCATATGTTAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200181    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144819.1-517s1c1
Sequence:CCGGCTGAAGGTGAAGAGCCACAAACTCGAGTTTGTGGCTCTTCACCTTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182408    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144819.1-525s1c1
Sequence:CCGGGAAGAGCCACAAACTGAGCATCTCGAGATGCTCAGTTTGTGGCTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177564    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_144819.1-1386s1c1
Sequence:CCGGCTAGAATATGAATCGCCTGAACTCGAGTTCAGGCGATTCATATTCTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144819.1-294s1c1
Sequence:CCGGCACAGATCTAACATATGAGCTCTCGAGAGCTCATATGTTAGATCTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216038    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144819.2-1630s1c1
Sequence:CCGGCTGATTGTGTGTTCATAATTTCTCGAGAAATTATGAACACACAATCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)