EMAIL THIS PAGE TO A FRIEND

CCDC93

coiled-coil domain containing 93

160 Gene Product Result for
Gene ID:
Mouse(70829) coiled-coil domain containing 93
Rat(304743) coiled-coil domain containing 93
domestic guinea pig(100735510) coiled-coil domain containing 93
naked mole-rat(101712191) coiled-coil domain containing 93
sheep(101110305) coiled-coil domain containing 93
Domestic Rabbit(100216512) coiled-coil domain containing 93
Zebrafish(678566) coiled-coil domain containing 93
domestic cat(101086165) coiled-coil domain containing 93
cow(616839) coiled-coil domain containing 93
Horse(100050022) coiled-coil domain containing 93
dog(476119) coiled-coil domain containing 93
chicken(424277) coiled-coil domain containing 93
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019044 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019044 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019044 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001025156 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001025156 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001025156 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019044 Rosetta Predictions human pricing
NM_001024997 Rosetta Predictions rat pricing
NM_001025156 Rosetta Predictions mouse pricing
NM_027567 Rosetta Predictions mouse pricing
NM_029955 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019044 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00024065 predicted 2067
2 SASI_Hs02_00352613 predicted 988
3 SASI_Hs02_00352614 predicted 951
4 SASI_Hs01_00024066 predicted 1926
5 SASI_Hs01_00024067 predicted 1476
6 SASI_Hs01_00024068 predicted 524
7 SASI_Hs01_00024069 predicted 1241
8 SASI_Hs01_00024071 predicted 1537
9 SASI_Hs01_00024072 predicted 1520
10 SASI_Hs01_00024073 predicted 2083
11 SASI_Hs01_00024064 predicted 1286
12 SASI_Hs01_00024070 predicted 1077
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024997 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00068729 predicted 1616
2 SASI_Rn01_00068730 predicted 1690
3 SASI_Rn01_00068731 predicted 199
4 SASI_Rn01_00068733 predicted 324
5 SASI_Rn01_00068734 predicted 297
6 SASI_Rn02_00202893 predicted 1083
7 SASI_Rn01_00068735 predicted 1644
8 SASI_Rn02_00202894 predicted 1202
9 SASI_Rn01_00068736 predicted 1729
10 SASI_Rn01_00068737 predicted 214
11 SASI_Rn01_00068732 predicted 1173
12 SASI_Rn01_00068738 predicted 510
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025156 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00030620 predicted 1318
2 SASI_Mm01_00030621 predicted 510
3 SASI_Mm02_00287784 predicted 1922
4 SASI_Mm01_00030622 predicted 1181
5 SASI_Mm02_00287785 predicted 1112
6 SASI_Mm01_00030624 predicted 1739
7 SASI_Mm01_00030625 predicted 1304
8 SASI_Mm01_00030626 predicted 1556
9 SASI_Mm01_00030627 predicted 1620
10 SASI_Mm01_00030628 predicted 305
11 SASI_Mm01_00030623 predicted 1009
12 SASI_Mm01_00030629 predicted 1289
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027567 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00075441 predicted 799
2 SASI_Mm01_00075442 predicted 491
3 SASI_Mm01_00075443 predicted 257
4 SASI_Mm01_00075444 predicted 641
5 SASI_Mm01_00075445 predicted 282
6 SASI_Mm01_00075446 predicted 222
7 SASI_Mm01_00075447 predicted 261
8 SASI_Mm01_00075448 predicted 293
9 SASI_Mm01_00075449 predicted 338
10 SASI_Mm01_00075450 predicted 666
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029955 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00336263 predicted 1310
2 SASI_Mm02_00336264 predicted 517
3 SASI_Mm02_00336265 predicted 1918
4 SASI_Mm02_00336266 predicted 1176
5 SASI_Mm02_00336267 predicted 1111
6 SASI_Mm02_00336268 predicted 1734
7 SASI_Mm02_00336269 predicted 1303
8 SASI_Mm02_00336270 predicted 1552
9 SASI_Mm02_00336271 predicted 1613
10 SASI_Mm01_00126418 predicted 305
11 SASI_Mm01_00126413 predicted 251
12 SASI_Mm01_00126414 predicted 270
13 SASI_Mm01_00126415 predicted 209
14 SASI_Mm01_00126416 predicted 511
15 SASI_Mm01_00126417 predicted 297
16 SASI_Mm01_00126419 predicted 510
17 SASI_Mm01_00126420 predicted 323
18 SASI_Mm01_00126421 predicted 246
19 SASI_Mm01_00126422 predicted 458
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019044
VALIDATED
CCDC93 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 93
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000262460    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_019044.3-5158s21c1
Sequence:CCGGCTAACCTGTGCCCTCATATTTCTCGAGAAATATGAGGGCACAGGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019044.3-1531s21c1
Sequence:CCGGTTACTACAGGCTCGAAGAAATCTCGAGATTTCTTCGAGCCTGTAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_019044.3-305s21c1
Sequence:CCGGGTATCACCACTTGCAACTTTGCTCGAGCAAAGTTGCAAGTGGTGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019044.3-226s21c1
Sequence:CCGGTTGGTTGCAGCTGGGTATTTCCTCGAGGAAATACCCAGCTGCAACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_019044.3-1480s21c1
Sequence:CCGGGACCTAGACAGACGGTATAATCTCGAGATTATACCGTCTGTCTAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019044.2-1163s1c1
Sequence:CCGGCCAGCCTACAAGCCAGATATACTCGAGTATATCTGGCTTGTAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019044.2-703s1c1
Sequence:CCGGGCAGAGGAGCTACTTGATGAACTCGAGTTCATCAAGTAGCTCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019044.2-1755s1c1
Sequence:CCGGGCTGAACTCAATTCATGAGAACTCGAGTTCTCATGAATTGAGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019044.2-1950s1c1
Sequence:CCGGGCTATACTTTAAGACTGTGAACTCGAGTTCACAGTCTTAAAGTATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019044.2-1617s1c1
Sequence:CCGGCGAGCTAATACAGTATCAGAACTCGAGTTCTGATACTGTATTAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019044
VALIDATED
CCDC93 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 93
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000262460    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_019044.3-5158s21c1
Sequence:CCGGCTAACCTGTGCCCTCATATTTCTCGAGAAATATGAGGGCACAGGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019044.3-1531s21c1
Sequence:CCGGTTACTACAGGCTCGAAGAAATCTCGAGATTTCTTCGAGCCTGTAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_019044.3-305s21c1
Sequence:CCGGGTATCACCACTTGCAACTTTGCTCGAGCAAAGTTGCAAGTGGTGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019044.3-226s21c1
Sequence:CCGGTTGGTTGCAGCTGGGTATTTCCTCGAGGAAATACCCAGCTGCAACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_019044.3-1480s21c1
Sequence:CCGGGACCTAGACAGACGGTATAATCTCGAGATTATACCGTCTGTCTAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019044.2-1163s1c1
Sequence:CCGGCCAGCCTACAAGCCAGATATACTCGAGTATATCTGGCTTGTAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019044.2-703s1c1
Sequence:CCGGGCAGAGGAGCTACTTGATGAACTCGAGTTCATCAAGTAGCTCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019044.2-1755s1c1
Sequence:CCGGGCTGAACTCAATTCATGAGAACTCGAGTTCTCATGAATTGAGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019044.2-1950s1c1
Sequence:CCGGGCTATACTTTAAGACTGTGAACTCGAGTTCACAGTCTTAAAGTATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019044.2-1617s1c1
Sequence:CCGGCGAGCTAATACAGTATCAGAACTCGAGTTCTGATACTGTATTAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019044
VALIDATED
CCDC93 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 93
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000262460    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_019044.3-5158s21c1
Sequence:CCGGCTAACCTGTGCCCTCATATTTCTCGAGAAATATGAGGGCACAGGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019044.3-1531s21c1
Sequence:CCGGTTACTACAGGCTCGAAGAAATCTCGAGATTTCTTCGAGCCTGTAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_019044.3-305s21c1
Sequence:CCGGGTATCACCACTTGCAACTTTGCTCGAGCAAAGTTGCAAGTGGTGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019044.3-226s21c1
Sequence:CCGGTTGGTTGCAGCTGGGTATTTCCTCGAGGAAATACCCAGCTGCAACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_019044.3-1480s21c1
Sequence:CCGGGACCTAGACAGACGGTATAATCTCGAGATTATACCGTCTGTCTAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019044.2-1163s1c1
Sequence:CCGGCCAGCCTACAAGCCAGATATACTCGAGTATATCTGGCTTGTAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019044.2-703s1c1
Sequence:CCGGGCAGAGGAGCTACTTGATGAACTCGAGTTCATCAAGTAGCTCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019044.2-1755s1c1
Sequence:CCGGGCTGAACTCAATTCATGAGAACTCGAGTTCTCATGAATTGAGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019044.2-1950s1c1
Sequence:CCGGGCTATACTTTAAGACTGTGAACTCGAGTTCACAGTCTTAAAGTATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019044.2-1617s1c1
Sequence:CCGGCGAGCTAATACAGTATCAGAACTCGAGTTCTGATACTGTATTAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001025156
VALIDATED
CCDC93 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 93
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000249351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025156.2-1629s21c1
Sequence:CCGGCAGTATCAGAAGCGATTTATTCTCGAGAATAAATCGCTTCTGATACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249353    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001025156.2-6812s21c1
Sequence:CCGGAGGTTAGAAACTACCATTAATCTCGAGATTAATGGTAGTTTCTAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001025156.2-1556s21c1
Sequence:CCGGGGCACGAAGAAATCGAGAAATCTCGAGATTTCTCGATTTCTTCGTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025156.2-1989s21c1
Sequence:CCGGGGCCGAAAGAATGAGCTATTACTCGAGTAATAGCTCATTCTTTCGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025156.2-249s21c1
Sequence:CCGGTTGGTCGCAGCTGGCTATTTCCTCGAGGAAATAGCCAGCTGCGACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001025156
VALIDATED
CCDC93 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 93
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000249351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025156.2-1629s21c1
Sequence:CCGGCAGTATCAGAAGCGATTTATTCTCGAGAATAAATCGCTTCTGATACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249353    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001025156.2-6812s21c1
Sequence:CCGGAGGTTAGAAACTACCATTAATCTCGAGATTAATGGTAGTTTCTAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001025156.2-1556s21c1
Sequence:CCGGGGCACGAAGAAATCGAGAAATCTCGAGATTTCTCGATTTCTTCGTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025156.2-1989s21c1
Sequence:CCGGGGCCGAAAGAATGAGCTATTACTCGAGTAATAGCTCATTCTTTCGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025156.2-249s21c1
Sequence:CCGGTTGGTCGCAGCTGGCTATTTCCTCGAGGAAATAGCCAGCTGCGACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001025156
VALIDATED
CCDC93 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 93
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000249351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025156.2-1629s21c1
Sequence:CCGGCAGTATCAGAAGCGATTTATTCTCGAGAATAAATCGCTTCTGATACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249353    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001025156.2-6812s21c1
Sequence:CCGGAGGTTAGAAACTACCATTAATCTCGAGATTAATGGTAGTTTCTAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001025156.2-1556s21c1
Sequence:CCGGGGCACGAAGAAATCGAGAAATCTCGAGATTTCTCGATTTCTTCGTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025156.2-1989s21c1
Sequence:CCGGGGCCGAAAGAATGAGCTATTACTCGAGTAATAGCTCATTCTTTCGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025156.2-249s21c1
Sequence:CCGGTTGGTCGCAGCTGGCTATTTCCTCGAGGAAATAGCCAGCTGCGACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks